ID: 1002048310

View in Genome Browser
Species Human (GRCh38)
Location 5:176554363-176554385
Sequence ACAACCCCACGGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002048304_1002048310 17 Left 1002048304 5:176554323-176554345 CCATGGTGATTGCAGTGGGAGGA 0: 1
1: 0
2: 2
3: 21
4: 287
Right 1002048310 5:176554363-176554385 ACAACCCCACGGAAGGAAGAAGG No data
1002048307_1002048310 -10 Left 1002048307 5:176554350-176554372 CCATAAGGTGAGGACAACCCCAC 0: 1
1: 0
2: 1
3: 8
4: 86
Right 1002048310 5:176554363-176554385 ACAACCCCACGGAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002048310 Original CRISPR ACAACCCCACGGAAGGAAGA AGG Intronic