ID: 1002048584

View in Genome Browser
Species Human (GRCh38)
Location 5:176556058-176556080
Sequence GGTCCCTGTGGCTGGGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 1, 2: 10, 3: 41, 4: 296}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002048584_1002048593 21 Left 1002048584 5:176556058-176556080 CCTGCAACCCAGCCACAGGGACC 0: 1
1: 1
2: 10
3: 41
4: 296
Right 1002048593 5:176556102-176556124 ACCTGGTTCTTCCCTGGCCCAGG 0: 1
1: 0
2: 3
3: 72
4: 401
1002048584_1002048588 -7 Left 1002048584 5:176556058-176556080 CCTGCAACCCAGCCACAGGGACC 0: 1
1: 1
2: 10
3: 41
4: 296
Right 1002048588 5:176556074-176556096 AGGGACCTTCTTTGAACTCCTGG 0: 1
1: 0
2: 1
3: 15
4: 139
1002048584_1002048590 4 Left 1002048584 5:176556058-176556080 CCTGCAACCCAGCCACAGGGACC 0: 1
1: 1
2: 10
3: 41
4: 296
Right 1002048590 5:176556085-176556107 TTGAACTCCTGGAATACACCTGG 0: 1
1: 0
2: 0
3: 9
4: 151
1002048584_1002048592 15 Left 1002048584 5:176556058-176556080 CCTGCAACCCAGCCACAGGGACC 0: 1
1: 1
2: 10
3: 41
4: 296
Right 1002048592 5:176556096-176556118 GAATACACCTGGTTCTTCCCTGG 0: 1
1: 0
2: 1
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002048584 Original CRISPR GGTCCCTGTGGCTGGGTTGC AGG (reversed) Intronic