ID: 1002049333

View in Genome Browser
Species Human (GRCh38)
Location 5:176561131-176561153
Sequence TTATGTACTTACTGTGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 0, 2: 5, 3: 73, 4: 538}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002049331_1002049333 9 Left 1002049331 5:176561099-176561121 CCTTTTCCTGCAATAATAACTTC 0: 1
1: 0
2: 1
3: 24
4: 274
Right 1002049333 5:176561131-176561153 TTATGTACTTACTGTGAGCTAGG 0: 1
1: 0
2: 5
3: 73
4: 538
1002049332_1002049333 3 Left 1002049332 5:176561105-176561127 CCTGCAATAATAACTTCTCACAT 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1002049333 5:176561131-176561153 TTATGTACTTACTGTGAGCTAGG 0: 1
1: 0
2: 5
3: 73
4: 538
1002049330_1002049333 13 Left 1002049330 5:176561095-176561117 CCGTCCTTTTCCTGCAATAATAA 0: 1
1: 0
2: 1
3: 25
4: 368
Right 1002049333 5:176561131-176561153 TTATGTACTTACTGTGAGCTAGG 0: 1
1: 0
2: 5
3: 73
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002049333 Original CRISPR TTATGTACTTACTGTGAGCT AGG Intronic
902670949 1:17973217-17973239 TTACATACCTACTGTGTGCTGGG - Intergenic
902719276 1:18293218-18293240 TTATGTACCCACTGTGTGCCAGG - Intronic
903364727 1:22799000-22799022 TTAGGTACCTGCTGTGTGCTCGG - Intronic
903663594 1:24993686-24993708 TTAAGCACTTACTATGTGCTAGG - Intergenic
904332853 1:29775250-29775272 TTATAGACTGAGTGTGAGCTAGG - Intergenic
904371377 1:30049613-30049635 TCAAGTACCTACTGTGTGCTGGG - Intergenic
905047520 1:35018569-35018591 TTAAGTACTTGCTATGTGCTAGG + Intronic
905850672 1:41272298-41272320 TTATATAATTGCTGTGAGTTTGG + Intergenic
907321297 1:53604114-53604136 TTAAGCACTAACTGTGAGCTAGG - Intronic
907889187 1:58621490-58621512 TTAGGTGCTTACTGTGTGCTAGG - Intergenic
908233851 1:62131778-62131800 TTATTTACTTATTTAGAGCTGGG - Intronic
908289747 1:62652563-62652585 TTATGGGTTTACTGTGTGCTGGG - Intronic
908310111 1:62872721-62872743 TTGAGTACTTACTGTGTGCCAGG - Intergenic
908685165 1:66709573-66709595 TTGAGTACTTGCTATGAGCTAGG - Intronic
909375206 1:74933026-74933048 GTATGTACATTCTATGAGCTTGG - Intergenic
909717493 1:78727211-78727233 TAATGTACTTAATGTGAGAGTGG - Intergenic
911068875 1:93816163-93816185 TTATGTGCCTACTGTGTGCCAGG - Intronic
911113766 1:94221382-94221404 TTAAGCACTTACTATGTGCTAGG + Intronic
911159943 1:94673893-94673915 TTATTTACTTATTTTGAGATGGG - Intergenic
911621822 1:100074004-100074026 TTAAGAACTTACTGGGTGCTGGG + Intronic
911869505 1:103077035-103077057 TTAAATGCTTACTGTGTGCTAGG - Intronic
912332897 1:108835349-108835371 TAATGTACTCACTGTGAGCCAGG + Intronic
912720609 1:112016780-112016802 TTATGTACTTACTATATGCTGGG - Intergenic
913141295 1:115943769-115943791 TTGAGGACTTACTATGAGCTAGG + Intergenic
913563718 1:120049149-120049171 ATATGTACCTATTGTGTGCTGGG - Intronic
913634406 1:120744414-120744436 ATATGTACCTATTGTGTGCTGGG + Intergenic
914284311 1:146208523-146208545 ATATGTACCTATTGTGTGCTGGG - Intronic
914388969 1:147201022-147201044 TTCTGTACTAACTTTGTGCTAGG + Intronic
914545343 1:148659264-148659286 ATATGTACCTATTGTGTGCTGGG - Intronic
914621225 1:149411410-149411432 ATATGTACCTATTGTGTGCTGGG + Intergenic
914918433 1:151832009-151832031 TTAATCACTTACTGTGTGCTGGG + Intergenic
914963547 1:152229341-152229363 TTATTTATTTACTTTGAGATGGG - Intergenic
915135868 1:153731066-153731088 ATATATGCTTACTGTGTGCTGGG + Intronic
915723487 1:158001227-158001249 TTGTGTGCTTACTGTGTGCTGGG + Intronic
917350174 1:174069367-174069389 TTAAGTGCTTACTGTGTGCGAGG - Intergenic
917963614 1:180165208-180165230 TTCTGTACTTAATGGGTGCTGGG + Intronic
918182112 1:182093338-182093360 TTATGTACCTACTGTGTGTCGGG + Intergenic
918564782 1:185916208-185916230 TTAAGAACCTACTGTGAGCTAGG - Intronic
918776645 1:188640263-188640285 TTAAGTATTTACTGTATGCTAGG - Intergenic
919058202 1:192597346-192597368 TTGTGTACTTACTGTGAGTAAGG - Intergenic
919869570 1:201810326-201810348 TTAGGGACATGCTGTGAGCTGGG - Intronic
920074498 1:203326620-203326642 TTGTGTACTTTCTAAGAGCTGGG - Intergenic
920320664 1:205119770-205119792 TAAAGTACTTTCTCTGAGCTAGG - Intronic
920386123 1:205571104-205571126 TTCTGCACTTACTGTGTGCCAGG + Intronic
920691300 1:208148598-208148620 TTATGTGCCTACCATGAGCTAGG + Intronic
921894141 1:220381370-220381392 TTGAGCACTTACTGTGAGATAGG + Intergenic
923238492 1:232057927-232057949 TTTTGTACTTACTATGAGTCAGG + Intergenic
923718985 1:236451318-236451340 TTGAGCACTTACTGTGTGCTAGG - Intronic
923786635 1:237074383-237074405 CTACGTACTAACTGTGAGATGGG + Intronic
924038721 1:239962312-239962334 TTATGTACCTACTATGAGCATGG - Intergenic
924836752 1:247656568-247656590 TGATGTACATTCTGTGAGTTTGG + Intergenic
1064068463 10:12204146-12204168 TTAATTAATCACTGTGAGCTGGG + Intronic
1066075454 10:31870912-31870934 TTAAGTACTAATTATGAGCTAGG + Intronic
1066202107 10:33151788-33151810 TTAGGTACTTACTTTGTGCCAGG + Intergenic
1067106904 10:43372611-43372633 TTTAGTGCTTACTGTGTGCTAGG + Intronic
1067712104 10:48657579-48657601 TGGTGTACTTAATGCGAGCTGGG - Intergenic
1068188980 10:53625323-53625345 TTATGTACTTATTTTAAGCCAGG - Intergenic
1068625185 10:59237643-59237665 TTAAGCCCATACTGTGAGCTAGG + Intronic
1068695377 10:59962896-59962918 GTAAGTACTTACTGTGTGCCAGG + Intergenic
1069668136 10:70178196-70178218 TTATGTATTTATTTTGAGATGGG - Intergenic
1069847193 10:71380462-71380484 TTATTTACCTACTATGAGCACGG - Intergenic
1070167148 10:73907369-73907391 TCATGGACCTACTGTGTGCTGGG - Intergenic
1070175181 10:73963866-73963888 TTGAGTGCTTACTGTGTGCTTGG + Intergenic
1070415634 10:76186686-76186708 TTGGGTAGTTACTGTGTGCTAGG + Intronic
1072263850 10:93708349-93708371 TTACATACTTACTATGAACTAGG - Intergenic
1072309907 10:94144834-94144856 TTGGGCACTCACTGTGAGCTGGG + Intronic
1072579037 10:96723999-96724021 TTACGTACCCACTGTGTGCTGGG - Intergenic
1073874231 10:107902703-107902725 ATATGCACTTACTTTCAGCTTGG - Intergenic
1074026236 10:109638279-109638301 TTAAGTACTTACTATGTGCCAGG - Intergenic
1074223833 10:111463887-111463909 TTAAGTACTTCCTTTGTGCTAGG + Intergenic
1074736929 10:116445152-116445174 CTCTGCACTTACTGTGGGCTAGG + Intronic
1075250008 10:120859651-120859673 TTAAATACTTACTGTGTACTAGG + Intronic
1075261685 10:120968863-120968885 TTGAGTACATATTGTGAGCTAGG - Intergenic
1075403092 10:122174973-122174995 TTATTTACTTATTTTGAGATAGG + Intronic
1075532525 10:123241854-123241876 TTATGTGCTTACTGCGTGCCAGG + Intergenic
1075569236 10:123527292-123527314 TTGTGTACTTACAGAGAGCAAGG - Intergenic
1075593810 10:123712602-123712624 TTGAGTACTTACTGTGGGCTGGG + Intronic
1076864228 10:133159538-133159560 TTAAGTACCTACTGTGTGCCTGG + Intergenic
1078297426 11:10087941-10087963 TTATGTACTTAATATGTGGTAGG + Intronic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1079584237 11:22105969-22105991 TTAAGTACTTACTGTGTGCTGGG + Intergenic
1080308212 11:30859780-30859802 TAATGAACTTGCTGGGAGCTTGG - Intronic
1081215392 11:40390530-40390552 TTAAGCATTTACTGTGTGCTAGG + Intronic
1081274698 11:41134101-41134123 TTATTTACTTATTTTGAGGTGGG + Intronic
1081506750 11:43725354-43725376 TTATGTGCTTACTATGTGCTAGG - Intronic
1082192285 11:49260852-49260874 TTATGTAGTTATTTTGAGATAGG - Intergenic
1082869379 11:57930151-57930173 TTGTGTATCTACTGTGTGCTGGG + Intergenic
1083372970 11:62196195-62196217 TTAGGGACTTAGTCTGAGCTGGG - Intergenic
1083435007 11:62636469-62636491 TTATTTACTTATTTTGAGATCGG - Intronic
1083742790 11:64719986-64720008 TTGTGTACCTACTGTGTGCCTGG - Intronic
1084376587 11:68782328-68782350 TTACGCACTTACTGTGACCTGGG - Intronic
1084611316 11:70204870-70204892 TCATGTAGTTACTGTGTGCTGGG + Intronic
1086334803 11:85789609-85789631 TTAGGTACTTACTATGTGCCAGG + Intronic
1086433644 11:86760057-86760079 TTCTGTACTTACTGTGTTCCAGG - Intergenic
1087262543 11:96026950-96026972 TTAAGTACTTACTATGTGCCAGG - Intronic
1087345899 11:96970718-96970740 TTACGTTCTTATTGTGTGCTAGG + Intergenic
1088146974 11:106692702-106692724 TTAAGTGCCTTCTGTGAGCTAGG + Intronic
1088337083 11:108717723-108717745 TTAAGTGCTTACTGTGTGCCAGG + Intronic
1088451831 11:109989505-109989527 TTATAAACTTCCTGTGATCTTGG - Intergenic
1088822660 11:113469974-113469996 TTGTGCACTTACTGTGTGCAGGG - Intronic
1088904482 11:114143937-114143959 TTATGCATTTCCTGTGTGCTCGG + Intronic
1088911628 11:114196640-114196662 TTAAGTACCTACTGTATGCTAGG + Intronic
1089117383 11:116106966-116106988 TTAAGAACTTACTGTATGCTAGG - Intergenic
1089361044 11:117886864-117886886 TTATGTACCTACTATGTGCCAGG + Intergenic
1089626480 11:119754375-119754397 TGACGTACTTTCTGTGACCTTGG - Intergenic
1089983434 11:122791186-122791208 TTATTTACCTACTTTGAGCAGGG - Intronic
1091103861 11:132900164-132900186 TTATGAACTTGCTGTGGGCATGG - Intronic
1091619135 12:2072849-2072871 ATGTGTGCTCACTGTGAGCTTGG + Intronic
1092846394 12:12589147-12589169 TCAAGTACTTACTGTGTGCCAGG + Intergenic
1093316763 12:17661600-17661622 TTATGCCCTTATTGTGAGCAAGG + Intergenic
1094039912 12:26111659-26111681 TTGAGTACTTACTGTGTGCCAGG + Intergenic
1094163343 12:27416302-27416324 TTTAGCACTTACTGTGTGCTAGG - Intronic
1095544517 12:43349074-43349096 TTATGTATGTCCTGTGATCTTGG - Intergenic
1096177431 12:49532075-49532097 TGAGGTACCTACTGTGTGCTAGG + Intergenic
1097921308 12:65077503-65077525 TTATGAACTTAGTGTGGGCTGGG + Intronic
1097975342 12:65679979-65680001 TTAAGTACTTACTATGTGCCAGG + Intergenic
1098010492 12:66045578-66045600 TCAAGTGCTTACTGTGTGCTGGG + Intergenic
1098267217 12:68734325-68734347 TTATGTAATTACAGTGGGTTAGG + Intronic
1098509999 12:71300498-71300520 TTGAATATTTACTGTGAGCTGGG - Intronic
1098604666 12:72375309-72375331 TTATTTACCTGCTGTGTGCTAGG - Intronic
1098868987 12:75795351-75795373 TTATTTACTTACTATGTGCCTGG - Intergenic
1099218795 12:79887146-79887168 TTATGTATTTGCTGTATGCTAGG - Intronic
1099277895 12:80601448-80601470 TTAAGTGCTTACTATGTGCTAGG - Intronic
1099987951 12:89690030-89690052 TTATGAACTTTCTGTATGCTAGG + Intronic
1100629560 12:96374012-96374034 TTAAATGCTTACTGTGTGCTAGG - Intronic
1100827230 12:98486259-98486281 TTAAGCACTTACTGGGTGCTGGG + Exonic
1100976313 12:100125865-100125887 TTATGATCTTACTATGTGCTGGG + Intronic
1101167287 12:102051867-102051889 TTGTGTACTTCCTCTGTGCTGGG - Intronic
1101591716 12:106130819-106130841 TTGTGTACCTACTGTGTGCCAGG + Intronic
1101617222 12:106350084-106350106 TGTTGTACTTACTGTGCACTTGG - Intergenic
1101793058 12:107948136-107948158 TTAGGTGCTTACTGTGTGCCAGG + Intergenic
1101881357 12:108628288-108628310 TTAAGCACCTACTGTAAGCTTGG - Intronic
1102741658 12:115212952-115212974 TTGTGTGCTTACTGTGTGCCAGG - Intergenic
1102750767 12:115291976-115291998 TTAAGAACTTACTATGTGCTAGG - Intergenic
1102773758 12:115501239-115501261 TTGAGTACTTACTATGTGCTGGG + Intergenic
1103037139 12:117665670-117665692 TTATGCACCTACTGTGTGCCAGG + Intronic
1103190731 12:118999525-118999547 TTATGAAATCACTGTGAGATTGG + Intronic
1103252338 12:119511061-119511083 TTGTGTTCCTACTGTGTGCTAGG - Intronic
1104443516 12:128814675-128814697 TTGTGTGCTTATTGTGTGCTGGG - Intronic
1104624722 12:130341843-130341865 CTAAGTGCTTCCTGTGAGCTGGG - Intronic
1106041650 13:26099229-26099251 TTGAGGACATACTGTGAGCTTGG - Intergenic
1106516045 13:30455002-30455024 TTTTGCACCTACTGTGAGCCTGG + Intergenic
1106697966 13:32198662-32198684 TTATGTGCTTACTTTGTGCCAGG - Intronic
1107151769 13:37119896-37119918 TTGAGTACTTGCTGTGTGCTGGG + Intergenic
1107761169 13:43680721-43680743 TTGAGTACTTGCTGTGTGCTGGG - Intronic
1107951610 13:45466881-45466903 TTATGTCCCTACTCTGAGTTAGG + Intronic
1108461736 13:50673831-50673853 TTAAGTACTTACTTTGTGTTAGG - Intronic
1108980376 13:56503601-56503623 TTATGTAATTATTATGAACTTGG - Intergenic
1109120011 13:58443527-58443549 TTAAATACTTACTGTGTGCCAGG + Intergenic
1109120897 13:58455610-58455632 TGGTGTTCTTACTGTGAGGTGGG - Intergenic
1110645883 13:77883596-77883618 TTATGTACTTATTGTGTTCCAGG - Intergenic
1110687611 13:78393677-78393699 TTATACACTTACTATGAGCCAGG - Intergenic
1111036351 13:82679219-82679241 TTATTTATTTATTGAGAGCTTGG + Intergenic
1111756752 13:92406519-92406541 TTCTGTACTTAATATGAGCCAGG + Intronic
1113259474 13:108545847-108545869 TTTAATACTTACTGTGTGCTTGG + Intergenic
1114940360 14:27602577-27602599 ACATGTACTTATTGAGAGCTTGG - Intergenic
1115104724 14:29746401-29746423 TTTTGTTCTTACTGTTACCTTGG + Intronic
1115573838 14:34692153-34692175 TAAAGTACTTACTCTGGGCTGGG - Intergenic
1116478851 14:45373259-45373281 GTATGTTCCTACTGTGTGCTAGG + Intergenic
1116512407 14:45762812-45762834 TTATTTATTTATTATGAGCTAGG - Intergenic
1117103022 14:52369820-52369842 TTAGGTACTTAATATGTGCTAGG + Intergenic
1117589216 14:57249100-57249122 TTAAGTACTTACTATGTGCCAGG + Intronic
1117717438 14:58595436-58595458 TCATTTACTTACTGTGATCTTGG + Intergenic
1118678361 14:68213209-68213231 TTGAGTACTTACTGTGTGCCAGG + Intronic
1118920885 14:70149122-70149144 TTTAGTACTTACTGTGTGCCAGG - Intronic
1118974695 14:70666552-70666574 TAAAGTACTTAATGTGGGCTTGG - Intronic
1119893320 14:78199416-78199438 TTATGCACTTACTATGTGCTGGG + Intergenic
1120219668 14:81718130-81718152 TTATGCACTTTCTCTGTGCTAGG + Intergenic
1120423780 14:84321372-84321394 TTATGTACGTAATGAGAGATAGG - Intergenic
1120634759 14:86938139-86938161 TAATGCACTTACGGTGATCTTGG - Intergenic
1121988447 14:98530633-98530655 CTGTCTACTCACTGTGAGCTGGG - Intergenic
1122432681 14:101665760-101665782 TTATGTGCTTATTGTGTGATAGG - Intergenic
1122938181 14:104969551-104969573 TTATGCACCTACTGTGTGCCAGG - Intronic
1123858697 15:24439743-24439765 TTTGGTATTTACTGGGAGCTTGG - Intergenic
1124241795 15:28034455-28034477 TTAAGAACTTACTTTGAACTGGG - Intronic
1124836037 15:33196875-33196897 ATATGTACTTGCTCTAAGCTTGG + Intergenic
1124991441 15:34677924-34677946 TTATGTACTTAAAGAGAGATAGG + Intergenic
1125899598 15:43332698-43332720 TTATGCACTTACCATGAGCCAGG - Intronic
1126432229 15:48598360-48598382 CTCTGTGCTTACTGTGTGCTAGG - Intronic
1126560729 15:50040886-50040908 TTGTGTACTCCCTGTGAGCTAGG + Intronic
1126605944 15:50476256-50476278 TTTTGTACTTTTCGTGAGCTGGG - Intronic
1126687109 15:51257943-51257965 TTAAGTGCTTACTCTGTGCTAGG + Intronic
1126830249 15:52595330-52595352 TTGAGTACTTACTATGTGCTAGG - Intronic
1126870462 15:52981528-52981550 TTGAGCACTTCCTGTGAGCTGGG - Intergenic
1126986531 15:54317001-54317023 TTATGTACTTACTGTATTCCTGG - Intronic
1127046513 15:55031759-55031781 TTGTGCATTTACTATGAGCTAGG - Intergenic
1127132368 15:55880860-55880882 TTGAATACTTACTGTGTGCTGGG - Intronic
1127230810 15:56992263-56992285 TTATTTATTTACTGTGAGACAGG - Intronic
1127238679 15:57086259-57086281 TTATGTGCTTACTATGTGCCAGG + Intronic
1127597803 15:60504192-60504214 TTGTGCACCTACTATGAGCTAGG + Intronic
1128507542 15:68286054-68286076 TTTTGTATGTACTGTGAGGTAGG + Intronic
1129305926 15:74662365-74662387 TTGTGTACTTACGCTGAACTGGG - Intronic
1129688415 15:77699272-77699294 GTATGCACTTACTGTGTGCAGGG - Intronic
1129688422 15:77699339-77699361 GTATGCACTTACTGTGTGCGGGG - Intronic
1129738929 15:77980459-77980481 TCAAGTACTGACTGTGTGCTAGG + Intergenic
1129847027 15:78772719-78772741 TCAAGTACTGACTGTGTGCTAGG - Intronic
1129882046 15:79013411-79013433 TTATGAACCTACTGTGTGCCAGG - Intronic
1130101544 15:80898380-80898402 TTAAGCACTTACTGTGTGCTAGG - Intronic
1130254877 15:82321172-82321194 TGAAGTACTGACTGTGTGCTAGG + Intergenic
1130600097 15:85268834-85268856 TGAAGTACTGACTGTGTGCTAGG - Intergenic
1131473536 15:92716678-92716700 TTGGGTACTTACTATGTGCTGGG + Intronic
1131962267 15:97802059-97802081 TTATGGACCTACTGTGTGCCAGG + Intergenic
1133321410 16:4915940-4915962 TGAAGTACCTACTGTGTGCTGGG - Intronic
1133373636 16:5265507-5265529 TTATGTTCTTACTGATAGTTGGG - Intergenic
1133453920 16:5926044-5926066 TGATGTTCTGACTGTTAGCTGGG + Intergenic
1135287249 16:21204715-21204737 TTGTGTTCTTACTGGGAGATAGG + Intronic
1136532972 16:30882295-30882317 TTGTGTACTTACTGTTTGCTGGG - Intronic
1136993893 16:35174363-35174385 CCATGTGCTTACTGTGAGCCTGG + Intergenic
1137519153 16:49177196-49177218 TTAGACACTTACTGTGTGCTAGG - Intergenic
1138304666 16:55963521-55963543 TTATGTACTTCCTGTGATCAAGG - Intergenic
1138822535 16:60278965-60278987 TTATGTACCTGCTGTGTGCCAGG - Intergenic
1139753269 16:69122097-69122119 TTTATTACTTACTGTGTGCTAGG + Intronic
1140821630 16:78668473-78668495 TTATATTCTTACTCTGGGCTAGG + Intronic
1140890803 16:79283317-79283339 GAATGTACTTATTGTGAACTGGG - Intergenic
1140909739 16:79440346-79440368 CTGTGTACCTACTGTGCGCTAGG - Intergenic
1141382966 16:83592182-83592204 TTGAGCACTTACTGTGTGCTAGG - Intronic
1141651055 16:85393473-85393495 TTAGGCACCTACTGTGTGCTGGG - Intergenic
1141783135 16:86178039-86178061 TTATGTACATGGTGTGAGGTAGG - Intergenic
1142549495 17:729638-729660 TTGAGTACTTACTGTTTGCTAGG - Intergenic
1143047705 17:4095456-4095478 TTAAGTACCTACTGTGTGCCAGG - Intronic
1143872655 17:9968427-9968449 TGATGGACTTAGAGTGAGCTGGG - Intronic
1144051130 17:11497985-11498007 TTAAGCACTTACTGGGAGCTGGG - Intronic
1145783440 17:27578821-27578843 TTATGCACCTACTGTGTGCCAGG + Intronic
1146001616 17:29133754-29133776 TTATGTTTTTCCTGTGTGCTTGG - Intronic
1147157292 17:38550672-38550694 TTAAGTACCTACTGTGTGCTAGG - Intronic
1147483689 17:40791583-40791605 TTTTGTACAGACTGTGAGCTAGG + Intergenic
1148159201 17:45440520-45440542 TTACGTGTTTACTGTGAGCTTGG - Intronic
1149370168 17:55986129-55986151 TTTTGTTCTTCCTGTGTGCTAGG - Intergenic
1149470174 17:56909926-56909948 TTATGCACTTACTGTATGCCAGG + Intronic
1150359228 17:64516042-64516064 TTATGCATTTACTCTGAGCTAGG - Intronic
1151460586 17:74252004-74252026 CTGAGCACTTACTGTGAGCTGGG - Intronic
1152610044 17:81310944-81310966 TTAAGCACGTACTGTGTGCTAGG - Intergenic
1153592947 18:6693692-6693714 TTTTGTACCTACTATGAGCTAGG - Intergenic
1153606001 18:6833767-6833789 TTTTGTAATTACTGTTATCTTGG + Intronic
1155096127 18:22558275-22558297 TTGAGTACTTACTATGTGCTAGG + Intergenic
1155474303 18:26222684-26222706 TTGAGTGCTTACTATGAGCTTGG - Intergenic
1155534784 18:26805894-26805916 TTATGTGCTTGCTATGAGCCAGG - Intergenic
1155874148 18:31064204-31064226 TTATGCACTTACTATGTGCCAGG + Exonic
1156364273 18:36411167-36411189 TTTTGTATTTAGTGTGAGGTAGG + Intronic
1156691663 18:39714749-39714771 TTGTGTACTTACTTTGTGCAAGG - Intergenic
1156920200 18:42513065-42513087 GTATGTACTTATTGTCAACTGGG + Intergenic
1157098066 18:44705060-44705082 ATATGTGCTGACTTTGAGCTGGG + Intronic
1157625738 18:49049596-49049618 TTAAGTACTTACTCTGTGGTGGG - Intronic
1157909888 18:51606469-51606491 TTTTGTGCATACTGTGAGGTAGG + Intergenic
1158915778 18:62127575-62127597 TTATGTACTTAGTGTATGCAAGG - Intronic
1159730399 18:72019478-72019500 TTATGTACTTATTTTGAAATTGG + Intergenic
1160314332 18:77826820-77826842 GTATGTACTTCCTTTCAGCTAGG + Intergenic
1160816184 19:1036857-1036879 TTATGTATTTATTTTGAGATAGG + Intronic
1161496029 19:4586219-4586241 TTGAGTGCTTACTGTGTGCTTGG - Intergenic
1161666496 19:5580156-5580178 TTGGGTACTTACTGCGAGCAGGG - Intergenic
1162190606 19:8943276-8943298 TTAAAAACTTACTATGAGCTGGG - Intronic
1162253749 19:9470321-9470343 TTATGTACTTACTGTATTCTAGG - Intronic
1162405242 19:10469194-10469216 TTTTGTACATACTGTAAGGTTGG + Exonic
1162754501 19:12849190-12849212 TTGAGTACCTACTGTGTGCTGGG - Intronic
1163242126 19:16070677-16070699 TTGAGTGCTTACTCTGAGCTAGG - Intronic
1165641201 19:37388602-37388624 TTATGTACTTGCTGTATGGTAGG - Exonic
1166624788 19:44341165-44341187 TTGGGTACTTACTGTGTGCCAGG - Intronic
1166646245 19:44533720-44533742 TTATTTATTTACTTTGAGATGGG - Intergenic
925725007 2:6864130-6864152 TTATGTGCTTGCTCTGAGCATGG + Intronic
926797017 2:16627431-16627453 TCAAGTACTTACTGTGTGTTGGG + Intronic
929472204 2:42205515-42205537 TTGAGTGCTTACTGTGAGTTAGG - Intronic
929476339 2:42253639-42253661 TTAAGTACTTTTTGTGTGCTAGG + Intronic
929971010 2:46576727-46576749 TTGTGTATTTACTGTGTGCCAGG + Intronic
930282133 2:49382105-49382127 TCATGTATTTACTTTGAGCTTGG + Intergenic
930340909 2:50113168-50113190 TTAAGTACCTACTGTGATCCAGG - Intronic
930656241 2:54009812-54009834 TCATGTACTTAATTTGTGCTAGG + Intronic
930886183 2:56329411-56329433 TTAAGTACTAACTATGTGCTAGG - Intronic
931037694 2:58261489-58261511 TGGTTTACTTGCTGTGAGCTTGG + Intergenic
931872096 2:66472439-66472461 TTAAGCACTTACTGTGTGCCAGG + Intronic
932017318 2:68044299-68044321 TTGAGTGCTTACTGGGAGCTAGG - Intronic
932102769 2:68915726-68915748 TTGATTTCTTACTGTGAGCTAGG - Intergenic
932231036 2:70084814-70084836 CTAGGTGCTTACTGTGTGCTGGG - Intergenic
932363668 2:71131280-71131302 GTCTGTAGTTGCTGTGAGCTGGG - Intronic
932818870 2:74882628-74882650 TTAAGCACTTACTGTGTGCCAGG + Intronic
933380134 2:81532312-81532334 TTATGTACTTACTATGCACTAGG + Intergenic
933488868 2:82959073-82959095 TTATTTACTTACTTTGAGAAAGG - Intergenic
933986130 2:87593776-87593798 TTAGGCATTTACTGTGAGCCTGG - Intergenic
934047415 2:88184358-88184380 TTATATATCTACTGTGAGCGAGG + Intronic
935388329 2:102524490-102524512 TTATGTTCTTCCTGTGACTTTGG + Intronic
936307706 2:111357027-111357049 TTAGGCATTTACTGTGAGCCTGG + Intergenic
936479415 2:112871216-112871238 TCTAGTACTTACTGTGTGCTGGG + Intergenic
936686332 2:114830584-114830606 TTATGAACCTACTGTGTGCTAGG - Intronic
936743944 2:115550766-115550788 TTATGTAATTGCTGTGAAGTCGG + Intronic
937027200 2:118709436-118709458 TTTTGCACTTACTATGTGCTAGG - Intergenic
937095626 2:119233601-119233623 TTGAGCACTTACTGTGTGCTAGG + Intronic
937484457 2:122299961-122299983 TTAAGTACTTACTAGGAGCCTGG + Intergenic
937544736 2:123003360-123003382 TTATTTATTTACTTTTAGCTTGG - Intergenic
937940584 2:127282448-127282470 TTAAGTGCTTCCTGTGTGCTAGG - Intronic
938620191 2:133043712-133043734 TTACGTACTTAGTCTGAGCTAGG - Intronic
939379538 2:141416411-141416433 TTAAGAATTTACTGTGGGCTAGG - Intronic
939949332 2:148450148-148450170 TTGGGTACTTACTATGTGCTAGG + Intronic
940739107 2:157486546-157486568 TTATGTGCTTTCTGTGACATAGG - Intronic
941578975 2:167271335-167271357 GTTTGTCCTTGCTGTGAGCTTGG - Intergenic
941747325 2:169100802-169100824 ATATTTACTTACTGTGTTCTGGG + Intergenic
941889606 2:170565446-170565468 TTAGGCACTTACTGTGTGCTAGG - Intronic
942158610 2:173158203-173158225 TTGAGTACCTACTGTGAGCTAGG - Intronic
943039310 2:182785432-182785454 TCAAGTACTTACTATGAGTTTGG + Exonic
943469408 2:188275246-188275268 TTTTGTCCTTACTGTCAGCTGGG + Intergenic
943824446 2:192371233-192371255 TTATGTAAATATTCTGAGCTTGG + Intergenic
944050511 2:195463215-195463237 TTAAGCACTTACTATGTGCTGGG - Intergenic
944350696 2:198723753-198723775 TTATGGATTTACTGTCATCTGGG - Intergenic
944469212 2:200035153-200035175 TTAAGAACTTACTATGTGCTAGG + Intergenic
945570839 2:211465572-211465594 TTATGTACTAACTGTCATTTAGG - Intronic
946072539 2:217046944-217046966 TTGTGTACTTACTGTGTGCCAGG + Intergenic
946076088 2:217074836-217074858 TTATGTTCTCACAGTGAGCCAGG - Intergenic
946327075 2:218990304-218990326 TTCTGTACTTACGGTGAGCTCGG - Exonic
946649255 2:221873261-221873283 TTAGGTGTCTACTGTGAGCTAGG + Intergenic
946845819 2:223858138-223858160 TTAAGTACCTACTATGTGCTAGG + Intronic
947042679 2:225941620-225941642 TTAAGCACTTACTATGTGCTGGG - Intergenic
947158581 2:227188782-227188804 TAAGGCACTTACTGTGTGCTAGG + Intronic
947339079 2:229118081-229118103 TTGAGTACTTACTATGTGCTAGG - Intronic
947406528 2:229783128-229783150 TTTTGTACTTTCTGCAAGCTAGG + Intronic
947726822 2:232406498-232406520 TTCTGTATTTCCTGGGAGCTGGG - Intergenic
948417708 2:237826261-237826283 TTGTGTACTTCCTGTGTGCCAGG + Intronic
948434363 2:237943311-237943333 TTATGTACTTAACAGGAGCTGGG - Intergenic
1168953856 20:1820609-1820631 TTGAGTACTCACTGTGAGCCAGG + Intergenic
1169251791 20:4066807-4066829 GGATGTACCTACTGGGAGCTTGG + Intergenic
1170022615 20:11852729-11852751 TTTGGTGCTCACTGTGAGCTGGG - Intergenic
1170143309 20:13146969-13146991 TTGTGCACCTACTGTGAGCCAGG - Intronic
1170695816 20:18657732-18657754 TCATGTAGTTTCTGTGAGCCAGG + Intronic
1171100447 20:22378252-22378274 GTATGTATTTTCTGTGATCTAGG + Intergenic
1172088554 20:32409576-32409598 TAATGTGCATACTTTGAGCTGGG + Intronic
1172261756 20:33573103-33573125 TTAGGTGCCTACTGTGTGCTAGG + Intronic
1172704360 20:36872208-36872230 TTGAGATCTTACTGTGAGCTGGG + Intergenic
1173021550 20:39271699-39271721 TTGAGTGCTTACTGTGTGCTAGG + Intergenic
1173335087 20:42106195-42106217 TTGTGTACCTACTGTGAGCCAGG - Intronic
1173460147 20:43236715-43236737 AAATGTACCTTCTGTGAGCTAGG - Intergenic
1173464537 20:43270583-43270605 TTGTGTGCCTACTATGAGCTGGG - Intergenic
1173684683 20:44914759-44914781 TCATGTACTTTCTGTGTGTTAGG + Intronic
1173820398 20:46016014-46016036 TGGTGTACCTACTGTGTGCTAGG + Intronic
1174225054 20:48991487-48991509 TTATGTACCTCTTGGGAGCTTGG + Intronic
1174393617 20:50233122-50233144 TTAAGCACCTACTGTGTGCTGGG - Intergenic
1174745274 20:53056119-53056141 TTGTGTACTTACTGTGTTCTAGG - Intronic
1174975624 20:55329755-55329777 TTATGTAGTCCCTGTGAGTTGGG - Intergenic
1175045491 20:56101010-56101032 TTAAGTGCTTATTGTGAGTTAGG + Intergenic
1175087469 20:56471889-56471911 TTAAGTGCTTACTGTGTGCCAGG - Intronic
1175097586 20:56553637-56553659 TTAAGCATTTACTGTGAGCCAGG - Intergenic
1175155828 20:56971002-56971024 TTACGTGCCTACTGTGTGCTAGG + Intergenic
1175285967 20:57836997-57837019 TTAAGCACTCACTGTGTGCTGGG + Intergenic
1175486104 20:59347508-59347530 TTATGTAGATACTGTGCCCTCGG - Intergenic
1175645965 20:60671929-60671951 CAATGTACTTACTATGTGCTTGG - Intergenic
1176728721 21:10467950-10467972 TTCTGTACTTACTTTGTGTTAGG - Intergenic
1177413286 21:20759437-20759459 TTATTTAGATACTGTGAACTAGG + Intergenic
1178332729 21:31713440-31713462 TTGTGTATTTACTCTGTGCTAGG - Intronic
1178754413 21:35334926-35334948 TTGAGTACTTAGTGTGTGCTGGG + Intronic
1180392601 22:12298287-12298309 TGATGTGCTTGGTGTGAGCTGGG + Intergenic
1180407147 22:12566481-12566503 TGATGTGCTTGGTGTGAGCTGGG - Intergenic
1180880320 22:19198854-19198876 TTGAGTACTTACTGTGTGCTAGG - Intronic
1181766091 22:25093087-25093109 TTGAGCACTTACTGTGTGCTAGG + Intronic
1182044169 22:27261404-27261426 TTAAGCACTTACTGTGTGCCAGG - Intergenic
1182873058 22:33665373-33665395 TTGAGTGCTTACTGTGTGCTTGG - Intronic
1183007790 22:34917740-34917762 TAATTTTCTTACTGTCAGCTGGG - Intergenic
1183136746 22:35896293-35896315 TTGTGCACCTACTGTGTGCTAGG - Intronic
1183269065 22:36849500-36849522 TTAAGCACTTACTGTGTGCCAGG + Intergenic
1183598477 22:38826358-38826380 TTAAGTACCTACCGTGTGCTAGG - Intronic
1183706885 22:39479665-39479687 TTGAGTGCTTACTGTGTGCTAGG + Intronic
1184630879 22:45778288-45778310 TTATGAACTTACTATGTGCCAGG + Intronic
1184903257 22:47461077-47461099 TTGTGTGCTTATTGTGAGCCAGG - Intergenic
1184965266 22:47966856-47966878 TAATGTGCTTACTCTGTGCTTGG - Intergenic
949204501 3:1421748-1421770 TTTTGTTTTTACTGTTAGCTGGG - Intergenic
949409284 3:3746241-3746263 TTATTTACTTACTGGGAGTAAGG - Intronic
949582274 3:5400761-5400783 CCATGTACTTTCTGTGAGCAAGG + Intergenic
950127961 3:10522132-10522154 CTGTGTACCTACTGTGAGCCAGG + Intronic
950293801 3:11810226-11810248 TTGAGTACCTACTGTGTGCTGGG - Intronic
950915971 3:16645737-16645759 TTAAATACATACTATGAGCTGGG + Intronic
951206179 3:19927877-19927899 TTATTTACTTCTTGTAAGCTTGG - Intronic
951616446 3:24551386-24551408 TTAAGTACTTACCTTGAGGTAGG + Intergenic
952422328 3:33143502-33143524 TTGAGTACCTACTGTGTGCTAGG + Exonic
952483507 3:33786574-33786596 TTGAGTACTTACTGTGTTCTGGG + Intergenic
953053358 3:39366582-39366604 TTAAACACCTACTGTGAGCTAGG + Intergenic
953517847 3:43613770-43613792 TCATGTGCTTACTATGAGCCAGG + Intronic
954001390 3:47560186-47560208 TTAAGCACTTACTCTGAGCTAGG - Intergenic
954024608 3:47772805-47772827 TGATGTACTTACAGGGAGTTTGG + Exonic
955214318 3:56972359-56972381 TTATGTACTTGGTGTGAACCAGG - Intronic
955215533 3:56982392-56982414 TTAAGTGCTTACTGTGTGCTAGG - Intronic
955891709 3:63657215-63657237 TAAAGTACTGACAGTGAGCTAGG + Intronic
955927307 3:64020677-64020699 TTAGGCACTTACTATGTGCTAGG + Intronic
956296269 3:67717011-67717033 CTGAGTACTTACTGTGTGCTAGG - Intergenic
956331492 3:68115234-68115256 TTATGCACTTACTGTTAGCATGG + Intronic
956523309 3:70129259-70129281 TTAAGTACTTACTGTGTTCCAGG + Intergenic
956649947 3:71495449-71495471 TTGAGTACTTGCTATGAGCTGGG - Intronic
957760864 3:84554437-84554459 TTATATACTTGCTGTGTGCAAGG - Intergenic
959670872 3:108975724-108975746 TTATGCACTTACTATATGCTAGG - Intronic
960083067 3:113561844-113561866 TTAAGTACTTAATGTCAGATGGG - Intronic
960575668 3:119227132-119227154 TGTAGTACTCACTGTGAGCTGGG - Intronic
961989413 3:131171695-131171717 TTTAGCACTTACTGTGTGCTGGG - Intronic
962035956 3:131651745-131651767 TTGTGTACCTACTGTGTGCCAGG - Intronic
962601110 3:136991435-136991457 TTAAGTACCTACTATGTGCTAGG - Intronic
962865138 3:139442281-139442303 TTGAGTACTTACTGTGTGCCAGG - Intergenic
963294321 3:143528831-143528853 TTAAGTACTTACTGTGTGCCAGG + Intronic
964363174 3:155920038-155920060 TTAAGTACTTTCTATGTGCTAGG + Intronic
965085738 3:164095150-164095172 CTGTGTACTTACTGTGTGCAAGG + Intergenic
965511912 3:169577233-169577255 TTAAGCACTTACTATGTGCTGGG - Intronic
965695156 3:171400563-171400585 TTATTTATTTATTGTGAGATAGG - Intronic
966624690 3:182003153-182003175 TTATGTACTTTATGTGTGTTGGG - Intergenic
966880809 3:184349641-184349663 TTGAGTATTTACTGTGTGCTAGG + Intronic
966978855 3:185111077-185111099 TTTTGTACTTAGTGTGAGACAGG - Intronic
967490039 3:190079818-190079840 TCATTTACTAACTGTGACCTAGG + Intronic
969012957 4:4082154-4082176 TTATGTTCTTACTGACAGTTTGG + Intergenic
969269235 4:6087716-6087738 TTATGTGCTAGTTGTGAGCTAGG + Intronic
969338366 4:6525397-6525419 TTATTTACTTATTTTGAGATGGG - Intronic
969498099 4:7537568-7537590 TTATGTACCTACTATGCACTGGG + Intronic
969740895 4:9025625-9025647 TTATGTTCTTACTGACAGTTTGG - Intergenic
969800229 4:9558488-9558510 TTATGTTCTTACTGACAGTTGGG - Intergenic
970702074 4:18753847-18753869 TAATGTACTTACTATGCCCTGGG - Intergenic
972287762 4:37665129-37665151 TTATAAAGTTACTGTGAACTTGG - Intronic
972675367 4:41255310-41255332 TTAAGAACCTACTGTGTGCTGGG - Intergenic
972803409 4:42502112-42502134 TAGTGTACTTACTATGTGCTAGG + Intronic
973681174 4:53321878-53321900 ATAAGCACTTTCTGTGAGCTGGG + Intronic
973966288 4:56165360-56165382 TTAAGTGCTTACTGTGTGCCAGG + Intergenic
975113639 4:70654259-70654281 TTTAGTACTTACTATGTGCTAGG - Intronic
975270121 4:72421400-72421422 TTATGCACCTACTTTGAGCCAGG - Intronic
975298647 4:72764296-72764318 TTAAGAACCTACTTTGAGCTAGG - Intergenic
975644752 4:76535212-76535234 TTCAGTACCTACTGTGTGCTAGG - Intronic
976519639 4:86011500-86011522 TTTTCTCCTTACTGTGAACTTGG + Intergenic
977020405 4:91752049-91752071 TTATGTACTAACTGTGATATAGG + Intergenic
977660939 4:99585193-99585215 CTAAGCACTTACTGTGTGCTAGG + Intronic
978058993 4:104312339-104312361 TTATATACTGTCTGGGAGCTAGG - Intergenic
978370507 4:108025500-108025522 TACTGTACTTACTGTGTGCCAGG - Intronic
979815820 4:125102360-125102382 TTTTGTAGCTACTGTGAGATTGG - Intergenic
979917753 4:126458493-126458515 CTTTGTACTTACTGTGTGCCAGG - Intergenic
981450105 4:144886788-144886810 TTGAGTACTTACTATGTGCTGGG - Intergenic
981468341 4:145099226-145099248 TTATGTAGTTAATGGGAGGTGGG - Intronic
981544391 4:145879324-145879346 AAATGTGCTTACAGTGAGCTGGG - Intronic
982540779 4:156667680-156667702 TTTTGTACATCCTGTAAGCTAGG + Intergenic
982638795 4:157930675-157930697 TTAAGTACTTATTGTGTGCTAGG + Intergenic
983173477 4:164561353-164561375 TTTTGTACATAATGAGAGCTAGG + Intergenic
983458433 4:167995281-167995303 TTTTCTACTTACTTTGAGTTTGG + Intergenic
984643017 4:182190951-182190973 TTGAGTACCTACTGTGTGCTAGG + Intronic
986135413 5:4973081-4973103 TTATGTTTTTGCTGTGAACTTGG + Intergenic
986235883 5:5909626-5909648 TTGTGTATCTACTGTGTGCTTGG - Intergenic
986881258 5:12174294-12174316 TTAAGTACTTCCTGTGAGCCAGG + Intergenic
987447379 5:18037159-18037181 TTCAGTACTTGCTGTGAGTTAGG + Intergenic
987694761 5:21313824-21313846 TTATTCACTCACTGTGAGCTTGG - Intergenic
988242228 5:28628401-28628423 TTAAGTACTTACTGTGTAGTAGG - Intergenic
988614425 5:32760844-32760866 TTTTGTATTTGCTGTGAGGTAGG + Intronic
989080395 5:37613706-37613728 CTAAGTACTTACTGTGAGCCAGG + Intronic
989334975 5:40305453-40305475 TTGTATACTTACTATGTGCTGGG - Intergenic
990792995 5:59503689-59503711 TTATGACCTTTCAGTGAGCTGGG + Intronic
991126548 5:63076039-63076061 TTATGTATTTACTGTATGCAAGG - Intergenic
991536811 5:67678204-67678226 TTATGTACTTATTGTGTGCTAGG + Intergenic
991745473 5:69735617-69735639 TTATTCACTCACTGTGAGCTTGG + Intergenic
991752234 5:69819610-69819632 TTATTCACTCACTGTGAGCTTGG - Intergenic
991797040 5:70315346-70315368 TTATTCACTCACTGTGAGCTTGG + Intergenic
991824851 5:70610931-70610953 TTATTCACTCACTGTGAGCTTGG + Intergenic
991831553 5:70694733-70694755 TTATTCACTCACTGTGAGCTTGG - Intergenic
991889419 5:71314901-71314923 TTATTCACTCACTGTGAGCTTGG + Intergenic
992037920 5:72799258-72799280 TTGAGTGCTTACTTTGAGCTAGG + Intergenic
992118932 5:73570870-73570892 TTGTGTACCTAATGTGAGCCAGG + Intronic
993316482 5:86413336-86413358 TTATGTGCTTACTATGTGCCTGG - Intergenic
994030594 5:95137418-95137440 TTGAGCACTTACTGTGTGCTAGG - Intronic
994093561 5:95828814-95828836 CTATGTACCTACTGTGTGCTGGG + Intergenic
994250305 5:97528401-97528423 TTAAGTGCTTACAGTGTGCTTGG + Intergenic
994307618 5:98225995-98226017 TTTTGTACTTGCAGTCAGCTTGG - Intergenic
994351345 5:98749859-98749881 TTGGGGACTTTCTGTGAGCTAGG - Intergenic
994763787 5:103890422-103890444 TTATATATTTAATGTGAACTTGG + Intergenic
995455150 5:112343498-112343520 TTGAGTACTTGCTGTGTGCTGGG - Intronic
997695050 5:135854598-135854620 TTATGTCCTTTCTCTGAGTTAGG + Intronic
997974881 5:138435380-138435402 TTATGTGCTTACTATGTCCTGGG - Intronic
998447471 5:142209873-142209895 TTATGTACTCATTATGTGCTGGG + Intergenic
999046771 5:148478211-148478233 TTTAGCACTTACTGTGCGCTAGG - Intronic
999479230 5:151930309-151930331 TTAAGTACTTTCTGTGTGCTAGG + Intergenic
999730617 5:154474414-154474436 TCAAGTCCTTACTGTGTGCTTGG + Intergenic
1000516738 5:162245573-162245595 TTATTTTCTTACTGTGTGCAAGG + Intergenic
1000632044 5:163601798-163601820 TTAAGTACTTACTATGAGCCAGG + Intergenic
1000843315 5:166248680-166248702 TTAAGTACCTATTATGAGCTGGG - Intergenic
1001304498 5:170561695-170561717 TTGTGTACCTACTGTGTGCCAGG - Intronic
1002049333 5:176561131-176561153 TTATGTACTTACTGTGAGCTAGG + Intronic
1002099366 5:176849813-176849835 GTATGTACTTGCTGGGGGCTGGG - Intronic
1002113769 5:176940796-176940818 TTATGTATTTACTATGTGCTAGG + Intronic
1002170073 5:177369993-177370015 TTATGTACCTACTGTGTGCCAGG + Intronic
1002544428 5:179929820-179929842 TTATAGACTTACTGTGATTTCGG - Intronic
1002596570 5:180327634-180327656 CTGTGCACTTACTGTGTGCTGGG - Intronic
1002771553 6:294314-294336 TTATGTACATACTATGAGCCAGG + Intronic
1003213274 6:4087129-4087151 TTAGGTACATACTGGGAGCAAGG + Intronic
1004174986 6:13331696-13331718 TTAAGCACTTACTGTGTGCCAGG - Intergenic
1004584677 6:16988076-16988098 TTATTGACATACTATGAGCTAGG - Intergenic
1004940280 6:20549612-20549634 TTATTTATTTACTTTGAGATGGG + Intronic
1004987373 6:21097974-21097996 TTATGCACTTACTGTGTGCCTGG + Intronic
1005331974 6:24759570-24759592 TTTTGTACTGCCTGGGAGCTAGG + Intergenic
1005435588 6:25807852-25807874 TTATCTACTTACTGTTTGATGGG + Intronic
1005556140 6:26986104-26986126 TTATTCACTCACTGTGAGCTTGG + Intergenic
1006657682 6:35610148-35610170 TTAAGCATTTACTATGAGCTGGG + Intronic
1007169274 6:39851131-39851153 TTCTGCATTTCCTGTGAGCTGGG - Intronic
1007328232 6:41080276-41080298 TTATGTACTTATTTTGAGATGGG - Intronic
1008868425 6:56243596-56243618 TTAAGCACTTACTATGAGCCAGG + Intronic
1008902256 6:56633902-56633924 TTCAGAACTTACTGTGAGATAGG - Intronic
1008970003 6:57356337-57356359 TTGTGTACTTACTATATGCTAGG - Intronic
1008979305 6:57464735-57464757 TTATGTACTTCCTGTGTGCCAGG + Intronic
1009158972 6:60258147-60258169 TTGTGTACTTACTATATGCTAGG - Intergenic
1009167439 6:60357727-60357749 TTATGTACTTCCTGTGTGCCAGG + Intergenic
1010378703 6:75203701-75203723 TTAAGTACCTACTGTGTGCTGGG - Intronic
1010587636 6:77673298-77673320 TTAAGTGCTTACTGTGTGCCAGG + Intergenic
1011059724 6:83251072-83251094 TTAAATACTTTCTGTGGGCTTGG + Intronic
1011879641 6:92009100-92009122 TTAAGCACTTACTATGGGCTAGG + Intergenic
1012530700 6:100232219-100232241 TCATTTACTGACTGTGACCTTGG + Intergenic
1012841805 6:104338149-104338171 TAATGAGCTTACTGTGTGCTAGG - Intergenic
1012852111 6:104458728-104458750 TTCTGTCCTTAATGTAAGCTAGG + Intergenic
1012898207 6:104976123-104976145 TTAATTACTTACTTTGTGCTAGG + Intronic
1014270942 6:119335258-119335280 GTATGTACTTACTAGCAGCTAGG - Intronic
1015273733 6:131363362-131363384 TTAAGCACTTACTGTGTGCCAGG + Intergenic
1016807196 6:148223761-148223783 TTATGTCATTTCTTTGAGCTTGG - Intergenic
1017247341 6:152240633-152240655 TTATGTGCTTACTGTTTGCTAGG + Intronic
1020863379 7:13523184-13523206 TTGAGTACTTACTGTGAGTCAGG - Intergenic
1021097840 7:16553501-16553523 TTAAGTGCTTATTATGAGCTGGG - Intronic
1021875858 7:25048468-25048490 TTAAGAACTTACTGTGGGCCAGG + Intergenic
1022315667 7:29243058-29243080 TTTTGTGTTTTCTGTGAGCTGGG + Intronic
1022449563 7:30502499-30502521 TTAAGTACTTACTGTGTGCTAGG - Intronic
1022640612 7:32178914-32178936 TTCAGTACTTGCTGTGTGCTGGG + Intronic
1022963416 7:35451684-35451706 TTATGAACTCACAGTCAGCTGGG - Intergenic
1026339489 7:69423187-69423209 TTGTGTACCTACTATGTGCTGGG + Intergenic
1026658669 7:72279319-72279341 GCATGTACTTACTTAGAGCTTGG - Intronic
1027955611 7:84875389-84875411 TTATGCACTTACTCTGAATTTGG + Intergenic
1028280740 7:88924867-88924889 ATATGTATTTACTGTGTACTAGG - Intronic
1028710268 7:93899397-93899419 TTATGTAATTACCATAAGCTAGG - Intronic
1029071609 7:97903778-97903800 TTATGTTCTTACTGACAGTTTGG + Intergenic
1030137494 7:106269735-106269757 TTCTGTACTTAATGTGGACTTGG + Intronic
1030330574 7:108265621-108265643 TTAAGCACTTACTGTGTGCCAGG + Intronic
1030537148 7:110782667-110782689 ATAGGTACTTACTATGTGCTAGG + Intronic
1031225813 7:119036452-119036474 TTATATACCTACTGTGTGCAAGG - Intergenic
1032851388 7:135798674-135798696 TTAGCTATTTACTGTGACCTTGG - Intergenic
1033291121 7:140083578-140083600 TTGAGTACTTACTGTGTGCAAGG - Intergenic
1033417107 7:141171986-141172008 TTGTGTACTTACTATGAGACAGG + Intronic
1033706313 7:143888380-143888402 TTATATTCTTTTTGTGAGCTTGG - Intronic
1034601373 7:152259992-152260014 TTCTGTACTTACTTTGTGTTAGG + Intronic
1036254700 8:7196226-7196248 TTATGTTCTTACTGACAGTTTGG + Intergenic
1036362788 8:8091264-8091286 TTATGTTCTTACTGACAGTTTGG - Intergenic
1036895774 8:12633925-12633947 TTATGTTCTTACTGACAGTTTGG + Intergenic
1036930236 8:12949860-12949882 TTATTTACTTATTTTGAGATAGG + Intronic
1037241465 8:16783694-16783716 TTGAGTACTTACTATGAGTTAGG - Intergenic
1037477372 8:19270742-19270764 TTAAGTTTTTACTGTGTGCTAGG - Intergenic
1037574570 8:20189151-20189173 TTATGTGCCTACTGTGTGCCAGG - Intergenic
1038026241 8:23593263-23593285 TCATGTACCTGCTGTGATCTTGG + Intergenic
1038177937 8:25198205-25198227 ATTTGTACTTTCTGTGAGCCTGG + Intronic
1038876279 8:31553864-31553886 TTAAGTGCTTACTGTGTCCTAGG + Intergenic
1039100269 8:33934143-33934165 TTGAGTTCTTACTGTGAGCTAGG + Intergenic
1040418232 8:47215252-47215274 TTATGTAATTTCTGAGAGTTGGG - Intergenic
1042063223 8:64844430-64844452 TTGAGTTCTTACTGTGTGCTAGG - Intergenic
1042155281 8:65839096-65839118 TTAAGTACCTACTATGAGCTGGG + Intronic
1042617083 8:70661412-70661434 TTATGTGGATACTGTGAGGTAGG - Exonic
1042840096 8:73114926-73114948 TTGAGTTCTTACTGTGTGCTAGG + Intronic
1043011371 8:74885563-74885585 TTGAGCACTTACTGTGTGCTTGG + Intergenic
1043305752 8:78792256-78792278 TTATGTACGTGGTGTGAGGTAGG - Intronic
1044149275 8:88753974-88753996 TTATGTACTGAACATGAGCTAGG - Intergenic
1044416066 8:91941884-91941906 TTGAGTACTTACTATGAGCCAGG + Intergenic
1044494846 8:92864794-92864816 TTAAGTACCTACTGTGTGCCAGG + Intergenic
1044500796 8:92953232-92953254 TTAACTACTTACTATGAGCTAGG - Intronic
1044572143 8:93732258-93732280 TTAGGCACTTACTATGTGCTAGG - Exonic
1045117177 8:98995673-98995695 TTTTTTACTTACTGTCAGGTGGG - Intergenic
1045806967 8:106173895-106173917 TTGAGTACTTACTGTGTGCAAGG - Intergenic
1045836851 8:106532515-106532537 TTGTGTGCTTACTGTGTGCCAGG - Intronic
1046018794 8:108638707-108638729 TTGAGCACTTACTGTGTGCTAGG + Intronic
1046112025 8:109737015-109737037 TTAAGCACTTACTATGAGCTAGG - Intergenic
1046206385 8:111003605-111003627 TGATGTACATTCTGTGAGTTTGG - Intergenic
1046563777 8:115872339-115872361 TGATTAACTTACTGTGGGCTTGG + Intergenic
1047386372 8:124413569-124413591 TTAGGTACCTACTATGAGCCTGG - Intergenic
1047720962 8:127638686-127638708 TTGAGTACTCACTGTGTGCTAGG - Intergenic
1047876420 8:129142785-129142807 TTAAGTACATCCTATGAGCTAGG - Intergenic
1049567469 8:143348580-143348602 TCTTGTACTCACTGAGAGCTGGG + Intronic
1050008989 9:1165778-1165800 TTAGGCACTTACTATGAGCCAGG + Intergenic
1050602688 9:7268677-7268699 TTGTGTACTTTCTTTGAGCCAGG - Intergenic
1050781298 9:9339567-9339589 TTATGTAACAACTGTGAGTTAGG - Intronic
1050811854 9:9758530-9758552 TTATGTACTTTCTGAGAACCTGG - Intronic
1051227024 9:14910117-14910139 TTCTGTATTTTCTGTGAGGTGGG - Exonic
1051930361 9:22378146-22378168 TTATGTACTTATCGTGTGCCAGG + Intergenic
1052182247 9:25543914-25543936 TTATGTACTTGGTATGGGCTAGG + Intergenic
1052275527 9:26671526-26671548 TTGTGTACTTACTATGTGCTAGG - Intergenic
1052535672 9:29743294-29743316 GTAAGTACTTAGTGGGAGCTAGG - Intergenic
1052779480 9:32765843-32765865 CTGAGTACCTACTGTGAGCTGGG - Intergenic
1054925669 9:70586254-70586276 TTTTGTTTGTACTGTGAGCTGGG - Intronic
1056458841 9:86789884-86789906 TTGAGCACTTGCTGTGAGCTTGG + Intergenic
1056515679 9:87347005-87347027 TTGTGTGCTTACTGTGTGCCAGG - Intergenic
1057482329 9:95455096-95455118 TTATTTTCTTCCTTTGAGCTGGG - Intronic
1057490119 9:95513976-95513998 TTTTGAGCTTACAGTGAGCTGGG + Intronic
1057798676 9:98175943-98175965 TTGAGTACTCACTGTGAGCCAGG + Intronic
1058952356 9:109915682-109915704 TTGAGTGCTTACTGTGTGCTTGG - Intronic
1059490647 9:114663918-114663940 TTATCTTCATACTGTGAGGTTGG - Intergenic
1059680328 9:116579707-116579729 TTATTTATTTACTTTGAGATGGG - Intronic
1059696985 9:116738806-116738828 GCATGTACTTACTGCGTGCTGGG - Intronic
1059711548 9:116872330-116872352 TTAGGCACTTACTGTGTGCCTGG - Intronic
1059892870 9:118824263-118824285 TTATTTATTTACTGTGAGTAAGG + Intergenic
1060058106 9:120433329-120433351 ATTTGTACTTGCTGTGAGTTGGG - Intronic
1060069351 9:120532866-120532888 TCAAGTACTTACTGTGTTCTAGG - Intronic
1060158275 9:121335648-121335670 TTTTGTACTTACTTTGTGCAAGG + Intergenic
1060202192 9:121657775-121657797 TTCTGTACTTACTAAGACCTGGG + Intronic
1060373681 9:123099041-123099063 TTAAGTACCTACTATGTGCTGGG - Intronic
1060597108 9:124855227-124855249 TTGAGTCCTTACTGTGTGCTAGG - Intronic
1060765474 9:126292480-126292502 TTGTGTACCTACTATGTGCTGGG - Intergenic
1061439789 9:130593365-130593387 TTAAGTACCTACTGTGTGATGGG - Intronic
1061922308 9:133788857-133788879 TTGTGCACCTACTGTGTGCTGGG - Intronic
1062006460 9:134240723-134240745 TTAGGCACCTACTGTGTGCTAGG + Intergenic
1203585524 Un_KI270746v1:66120-66142 TTCTGTACTTACTTTGTGTTAGG + Intergenic
1185551687 X:987063-987085 TTATGTACTTATTTTGAGGTAGG - Intergenic
1185628614 X:1500281-1500303 TTATGTACTTATTTTGAGGTAGG + Intronic
1185761583 X:2692819-2692841 TTTTGCACCTACTGTGGGCTTGG + Intronic
1187308808 X:18121424-18121446 TTGTGCACTTACTGTGTGCTAGG - Intergenic
1188581022 X:31713801-31713823 TTATGTGCTTACAGTGTGCAAGG - Intronic
1188680735 X:33000967-33000989 TTATAAATTTACTGTGCGCTAGG + Intronic
1191958919 X:66677817-66677839 TTAAGTGCTTACTATGAACTAGG + Intergenic
1192269255 X:69563508-69563530 TCATGCACTTACTGTGTGCCAGG - Intergenic
1192359281 X:70428794-70428816 TTAAGTACTTACTATGTGCCAGG - Intronic
1193425161 X:81333335-81333357 TTGTGCACTTACTGTGATGTTGG + Intergenic
1194540688 X:95167824-95167846 TTAAGCACTTCCTGGGAGCTGGG - Intergenic
1194638347 X:96373115-96373137 TTAAGCACCTACTGTGAGCAAGG + Intergenic
1194858417 X:98963111-98963133 TAATATACTTGCTTTGAGCTGGG + Intergenic
1195326051 X:103759442-103759464 TTAAGTACTTACTGTGTGCTAGG - Intergenic
1195683722 X:107567336-107567358 TTGAGTACTTACTGTGTGCCAGG - Intronic
1195898239 X:109770918-109770940 TTTTGTACATTCTGTGAGTTTGG - Intergenic
1196227554 X:113184438-113184460 TGATGTACTTTCTATGAGTTTGG - Intergenic
1196715728 X:118809306-118809328 TTATGCACTTACAATGAGCAGGG - Intergenic
1197766303 X:130061240-130061262 TTAAGAACCTACTGTGTGCTAGG + Intergenic
1197815199 X:130491061-130491083 TTGAGAACCTACTGTGAGCTAGG - Intergenic
1197871526 X:131066896-131066918 TTAAGTACCTACTGTGTACTGGG - Intronic
1198594433 X:138220908-138220930 GTGTGTACTTACTGTGTGCCAGG + Intergenic
1198990386 X:142507368-142507390 TTAAGTACTTACTAAGTGCTGGG + Intergenic
1200272713 X:154701225-154701247 TTAAGTACTTTCTGTGTTCTAGG - Intronic
1200850040 Y:7873680-7873702 GACTGTACTTACTGTCAGCTGGG + Intergenic