ID: 1002053213

View in Genome Browser
Species Human (GRCh38)
Location 5:176583729-176583751
Sequence AGTTGTGTGCAGGAGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 248}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002053202_1002053213 23 Left 1002053202 5:176583683-176583705 CCCGGAGCCCAGCTCTGACTGAG 0: 1
1: 0
2: 3
3: 26
4: 315
Right 1002053213 5:176583729-176583751 AGTTGTGTGCAGGAGGGACAGGG 0: 1
1: 0
2: 0
3: 25
4: 248
1002053203_1002053213 22 Left 1002053203 5:176583684-176583706 CCGGAGCCCAGCTCTGACTGAGC 0: 1
1: 0
2: 3
3: 47
4: 342
Right 1002053213 5:176583729-176583751 AGTTGTGTGCAGGAGGGACAGGG 0: 1
1: 0
2: 0
3: 25
4: 248
1002053201_1002053213 24 Left 1002053201 5:176583682-176583704 CCCCGGAGCCCAGCTCTGACTGA 0: 1
1: 0
2: 0
3: 25
4: 285
Right 1002053213 5:176583729-176583751 AGTTGTGTGCAGGAGGGACAGGG 0: 1
1: 0
2: 0
3: 25
4: 248
1002053205_1002053213 15 Left 1002053205 5:176583691-176583713 CCAGCTCTGACTGAGCACAGAGC 0: 1
1: 0
2: 5
3: 78
4: 337
Right 1002053213 5:176583729-176583751 AGTTGTGTGCAGGAGGGACAGGG 0: 1
1: 0
2: 0
3: 25
4: 248
1002053204_1002053213 16 Left 1002053204 5:176583690-176583712 CCCAGCTCTGACTGAGCACAGAG 0: 1
1: 0
2: 4
3: 33
4: 377
Right 1002053213 5:176583729-176583751 AGTTGTGTGCAGGAGGGACAGGG 0: 1
1: 0
2: 0
3: 25
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002053213 Original CRISPR AGTTGTGTGCAGGAGGGACA GGG Intronic
900720226 1:4171207-4171229 GGTTTGGTGCAGGGGGGACAGGG + Intergenic
903197792 1:21705487-21705509 TGTTGTCTTCAAGAGGGACAAGG + Intronic
904268167 1:29329967-29329989 AGGAGCGTGCAGGAGGGACGTGG - Intergenic
905472591 1:38204677-38204699 AGTTGTGTACAGTAGAGACGTGG - Intergenic
907046603 1:51303515-51303537 GGTTGGGAGCAGGAGAGACACGG + Intronic
907751824 1:57270132-57270154 AGTGGCGTGCAGGAGGAAGAGGG - Intronic
908080288 1:60569970-60569992 AGTAGTGTGCAGGCGGAACAGGG + Intergenic
909593701 1:77380734-77380756 AGATGTGTGCCGCAGAGACAAGG + Intronic
911424392 1:97687970-97687992 AGTTGAGTGGGGCAGGGACAGGG + Intronic
915001658 1:152599963-152599985 AGAGGTGGGCAGGAGGTACAGGG + Intronic
917674395 1:177305288-177305310 AGTTGTGTGCAGGCTGGCAAAGG + Intergenic
918969640 1:191397645-191397667 AGCTGTGTGCAGCAGGTACCTGG + Intergenic
919814766 1:201430359-201430381 AGTTCTGTGCAGCTGGGACCAGG - Intergenic
919981184 1:202643705-202643727 AGGTGTGTGCGGGAGGGACTAGG + Intronic
920414746 1:205791448-205791470 TGTGGGGTGGAGGAGGGACAGGG + Exonic
921946198 1:220887629-220887651 GGTTGTGTGCAGGAGGGGCGGGG - Intergenic
922320166 1:224480028-224480050 AGAAGTTTGCAGCAGGGACAGGG - Intronic
923051018 1:230391562-230391584 AGGTGTGAGGAGGAGGGAGAGGG - Intronic
1062962141 10:1580576-1580598 ATTTGTGGGGAGGAGGTACAGGG - Intronic
1063374010 10:5541103-5541125 AGATGAGTCAAGGAGGGACAGGG - Intergenic
1063860003 10:10296532-10296554 AGATGGGTGAAGGAGGGAGAAGG - Intergenic
1064964717 10:21003376-21003398 AGGTGTTGGCAGCAGGGACATGG - Intronic
1065902403 10:30220529-30220551 AGTGTTGTGGAGGAGGGAGAGGG - Intergenic
1066430958 10:35351043-35351065 AGTTGTGTGCTATATGGACAGGG - Intronic
1066543030 10:36469758-36469780 CTATGTGTGCAGGAGGGAGAGGG - Intergenic
1067558035 10:47285808-47285830 AGAGGTGTGAAGGAGGGGCAGGG + Intergenic
1070050671 10:72886609-72886631 ATTTGTGTTCTGGAGGGAGAGGG - Exonic
1072734793 10:97872042-97872064 AATTGTGGGCAGCAGGGAAAAGG - Intronic
1073112764 10:101072363-101072385 ACATGTGTGCAGGAAGGCCAAGG + Intergenic
1073154071 10:101332701-101332723 GGTTGAGGGCAGGAGGGGCAAGG - Intergenic
1073443112 10:103564487-103564509 GGCTGTGTGCAGGAGGGGCTGGG - Intronic
1073462281 10:103672846-103672868 GGCTGTGTGAGGGAGGGACATGG - Intronic
1073673291 10:105616473-105616495 AAATGTATGCAGGAGGGAAAGGG - Intergenic
1074434726 10:113424410-113424432 AGTGGTATGGGGGAGGGACATGG - Intergenic
1074920164 10:118000341-118000363 AGTTGGGTGGAGAAGGGAAACGG - Intergenic
1076725661 10:132411830-132411852 AGTTTTGTGCAGGAAGCTCAAGG - Intronic
1076850513 10:133090183-133090205 AGTTGTTCGCAGAAGGGCCAAGG - Intronic
1078760205 11:14245549-14245571 TGCTGTGTGGAGGAGGGACATGG + Intronic
1083731274 11:64653894-64653916 TCTTGGGGGCAGGAGGGACAGGG - Intronic
1083881824 11:65552748-65552770 GGTTGACTGCAGGAGGAACAAGG - Intronic
1084039356 11:66532384-66532406 AGTGATGTGCATGAGGGACGTGG - Exonic
1084979084 11:72819363-72819385 AGCTGTATGGAGAAGGGACAGGG - Intronic
1091039783 11:132266179-132266201 TTTTGTGGGAAGGAGGGACAGGG + Intronic
1092258756 12:6941353-6941375 AGCTGTGAGCAGGAAGGGCAAGG - Exonic
1092683995 12:11019998-11020020 AGGTGTGTGAAGTAGAGACAAGG - Intronic
1092688301 12:11075657-11075679 AGGTGTGTGAAGTAGAGACAAGG - Intronic
1092804931 12:12212456-12212478 AGTTGTTGGCTAGAGGGACAAGG - Intronic
1095746369 12:45663638-45663660 AGTTCTGTGAAAGAGGGACTTGG + Intergenic
1096008667 12:48193994-48194016 GTGTGTATGCAGGAGGGACAAGG + Intergenic
1100429809 12:94521243-94521265 AGTTGTATACAGTGGGGACAAGG + Intergenic
1101799957 12:108013034-108013056 AGTTCTGTGCAAGAGAGAGAGGG - Intergenic
1102227251 12:111237517-111237539 AGTTATGTTCAGGAGAGACAGGG - Intronic
1103140078 12:118540788-118540810 AGTGGTGTGGTGGAGGGACAGGG - Intergenic
1104466774 12:128996813-128996835 AGTGGGATGCAGGAGGGGCAGGG + Intergenic
1104545176 12:129704575-129704597 AGTTGGGTGCAGGGGCCACATGG - Intronic
1104724123 12:131065726-131065748 AGTTGTGCGCATGAAGGAGAGGG + Intronic
1104889195 12:132132193-132132215 AGTTTTGAACAGGAGGCACATGG + Intergenic
1105558208 13:21465729-21465751 AGTTGAGGGCAGGATGTACACGG - Intergenic
1105955818 13:25281775-25281797 AGTTGTGTGCAGGAAGTGGAGGG + Intronic
1106344019 13:28858719-28858741 TGTTGTGTGGAGAGGGGACAGGG + Intronic
1109648935 13:65298965-65298987 AACTGTGTGCATCAGGGACAGGG - Intergenic
1110029233 13:70585216-70585238 ATGTCTGTGCAGGAGGGTCATGG + Intergenic
1111301436 13:86355792-86355814 AGAGGTTTGGAGGAGGGACAGGG - Intergenic
1113788425 13:113015058-113015080 AGGTGGGTGGAGGAGGGTCAGGG + Intronic
1114577722 14:23728938-23728960 TGTAGAGTGCAGGAAGGACATGG - Intergenic
1114933656 14:27506801-27506823 ATATGTGTGCTGGAGGGGCAAGG + Intergenic
1115006856 14:28496381-28496403 GGTGGTGTGCAGGAGGGAGGTGG + Intergenic
1115037386 14:28874913-28874935 AGTAGTGTACATGAGGGGCAGGG + Intergenic
1117292169 14:54344623-54344645 GTTTGTGTGGAGGAGTGACACGG - Intergenic
1118403341 14:65399624-65399646 AGTTTTGTGTTAGAGGGACATGG + Intergenic
1119701588 14:76759424-76759446 AGTAGTGAACAAGAGGGACATGG - Intergenic
1119829736 14:77691089-77691111 AGTTATGTGCAGGCCGGGCACGG - Intronic
1122987973 14:105221338-105221360 AGTTGTGTCCAGGAGTCCCATGG - Intronic
1123114721 14:105889544-105889566 AGTTGTGGGCAGGAGGGGTTAGG + Intergenic
1123118940 14:105908221-105908243 AGCTGTGGGCAGGAGGAGCACGG + Intergenic
1123154108 14:106207978-106208000 GGGTGTGTGCAGGAGGGGAAGGG + Intergenic
1123397783 15:19954714-19954736 AGTTGTGTTCATGAGGAAGATGG - Intergenic
1123704797 15:22943408-22943430 AGGTGCTTGAAGGAGGGACATGG - Intronic
1124416477 15:29476616-29476638 AGAAGTGTCCAGGAAGGACAAGG - Intronic
1124496878 15:30192435-30192457 AGGTGTGTGCGGGACGGACTAGG + Intergenic
1124746698 15:32346212-32346234 AGGTGTGTGCGGGACGGACTAGG - Intergenic
1129684589 15:77677834-77677856 AGTTGTGGGCAGGATGGTCTGGG - Intronic
1129716873 15:77857411-77857433 AGTTGTAGGCAGGGGGGACGTGG + Intergenic
1130350108 15:83084081-83084103 GGATGTGTGCAGGAGGGAATAGG - Intergenic
1131830842 15:96353871-96353893 GGTCGTGTGCAGGAGGGGGAGGG - Intergenic
1134876893 16:17708481-17708503 AGATGTGTGCAGGAGATACAAGG - Intergenic
1136220736 16:28826448-28826470 GTTTGTGTGCAGGTGGAACATGG + Intronic
1137481674 16:48856961-48856983 AGTTGTGTGCATGGGGAAGATGG + Intergenic
1138241306 16:55429430-55429452 ATGTGTGTGCAGCAGGAACATGG + Intronic
1138336787 16:56259678-56259700 AGTGGTCTGCAGAAGGGGCAGGG + Intronic
1138444310 16:57053911-57053933 AGATGTGTGCAGCAGGGTGAAGG + Intronic
1139802280 16:69532964-69532986 ACGTGAGTGCAGGAGGGAAAAGG - Intergenic
1140231717 16:73122828-73122850 AGTGGTGTGGAGGAGCGAGAAGG + Intergenic
1140767059 16:78169750-78169772 CGTTGTTTGCAGGAGGAAAAGGG + Intronic
1141510073 16:84506141-84506163 TGATGTGTGCAGGAAGTACAGGG - Intronic
1143178397 17:4969342-4969364 AGGGGTGGGGAGGAGGGACAGGG + Intronic
1143396355 17:6601232-6601254 AGTTGTGTGAAGTAGGGAAAGGG - Intronic
1143588594 17:7865822-7865844 GGTTGTGTGTAGGGGAGACAGGG + Intronic
1143865329 17:9918966-9918988 AGTCCTGTGCTGGATGGACAGGG + Intronic
1147897723 17:43761856-43761878 AGTTGTGGGAGGGAGGGAAAAGG - Intergenic
1150119492 17:62588340-62588362 AACTGTTTGAAGGAGGGACAAGG - Intronic
1151627693 17:75287788-75287810 AGGTGTGTGCAGGAGGGGAAAGG - Intronic
1152159364 17:78657861-78657883 GGATGTGTGCAGGAGGGACTCGG + Intergenic
1153769751 18:8405784-8405806 AGCTTTGTGCAGGAGGGTCAGGG - Intronic
1156399718 18:36729326-36729348 AGTTGGGTGCAGGTGGCACCTGG - Intronic
1157162477 18:45326677-45326699 ATTTGGGTGCAGGAAGCACAAGG - Intronic
1158445108 18:57513021-57513043 AGTTGTGAGCAGGAAGGGGAAGG - Intergenic
1158628642 18:59093039-59093061 AGTTGTGTGCAGAAGCCCCAGGG - Intergenic
1159721172 18:71893082-71893104 AGTACTGTACAGGAGGGAGAGGG - Intergenic
1160403037 18:78624968-78624990 TGTTCTGTGCAGGATGGAAAGGG + Intergenic
1161009097 19:1951538-1951560 TGTGGTGTGCATGACGGACAGGG + Intronic
1162850682 19:13429032-13429054 AGATGTGTGCCCGAGGGTCAAGG - Intronic
1162853873 19:13453120-13453142 TGGTGAGTGCAGGAGGGTCAGGG - Intronic
1164562543 19:29302541-29302563 ATCTGTGTGCAGGAGGGCCTGGG + Intergenic
1164604740 19:29589590-29589612 ATCTGTGTGAAGGAGAGACATGG + Intergenic
1164877252 19:31700199-31700221 AGATGTGTGCTGGAGGAAGATGG + Intergenic
1165176472 19:33934190-33934212 AGGTGTGTCCAGGAGCCACAGGG + Intergenic
1165282266 19:34807469-34807491 ACCTCTGTGCAGTAGGGACAAGG + Intergenic
1165421465 19:35724057-35724079 TCTTTTGTGTAGGAGGGACAAGG + Intronic
1165782084 19:38440863-38440885 AGGTCTGTGCAGGAGGGAGAGGG + Exonic
1166410256 19:42552020-42552042 CGGTGTGTGCAGGTGGGATAAGG + Intronic
1167320492 19:48794772-48794794 AGTCGGGGGCAGGAGGAACAGGG + Intergenic
1167420102 19:49397738-49397760 GGGTGTGGGCAGGAGGGTCAGGG - Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
928124639 2:28607054-28607076 AGCTGTATGGAGGAGGGACGAGG + Intronic
931457579 2:62424236-62424258 TGGTGTGTGCAAGAGGGACTTGG + Intergenic
932087718 2:68776471-68776493 AGTTGTGGGCTGGAGGAAAATGG + Intronic
936971815 2:118183781-118183803 ACTTGTGTGCAGGAGAGGGAGGG + Intergenic
937243359 2:120476518-120476540 GGTTGTGTGGAGGAGGGGCTGGG + Intergenic
938094282 2:128451527-128451549 AGTGGAGGGCAGGAGGGGCAAGG + Intergenic
939251793 2:139690141-139690163 AGTTTAGTGCAGGAGGTATATGG + Intergenic
939998205 2:148940169-148940191 AGTTGGCTGCAGGAAGGACTGGG + Intronic
940843578 2:158614341-158614363 AATGGTGTGCTGGAGTGACATGG + Intronic
942897470 2:181074715-181074737 AGTTGTTTGCAGGGGGGAGGGGG - Intronic
943496172 2:188623416-188623438 AGTTGTGTGCATTAAGGACAGGG + Intergenic
945569317 2:211445206-211445228 AGTTGTGTGGAGGACAAACAAGG + Intronic
946277695 2:218643488-218643510 AGTTTCCTGCAGGAGGGACTGGG + Exonic
946277711 2:218643548-218643570 AGTTTCCTGCAGGAGGGACTGGG + Exonic
946277724 2:218643608-218643630 AGTTTCCTGCAGGAGGGACTGGG + Exonic
946305986 2:218857363-218857385 GACTGAGTGCAGGAGGGACAAGG + Intergenic
947435843 2:230071416-230071438 GGGTGTGTGGAGGTGGGACAAGG - Intergenic
948869196 2:240789848-240789870 AGTTGGGTGGAGGAGGGAGGGGG - Intronic
1170685405 20:18565219-18565241 AGTTGTCTGCAGTAAGGGCATGG - Intergenic
1171135626 20:22692148-22692170 CGCTGCTTGCAGGAGGGACAGGG - Intergenic
1171284779 20:23928211-23928233 ACTTGCCTGCAGGAGGCACAAGG - Intergenic
1173190967 20:40875361-40875383 AGTTGTTTTCAGGAGGCAAATGG + Intergenic
1173681122 20:44882873-44882895 AATTGTGTGGAGGAGGGAGAGGG + Intergenic
1175664696 20:60848498-60848520 AGTTGTGGCCAGGAGGGAGATGG + Intergenic
1175942293 20:62543033-62543055 AGATGTGTGAAGGAGGGGCGAGG + Intergenic
1176744264 21:10637563-10637585 AGTTGTGTTCATGAGGAAGATGG - Intergenic
1181990418 22:26832744-26832766 AGTCGGGGGCAGGATGGACAGGG - Intergenic
1182379193 22:29872631-29872653 AGTTCTGGGCAGAAGGGAGAAGG + Intergenic
1182772503 22:32805385-32805407 AATTGTGTGTAAGAGGGAGAGGG - Intronic
1183462088 22:37957557-37957579 AGTTATGTTCTGGAGAGACATGG + Intronic
1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG + Intergenic
1185025453 22:48407479-48407501 CGGTGTGGGCAGGAGGGAAAAGG - Intergenic
950310088 3:11949547-11949569 GGTTTTGTTCAGGGGGGACAGGG + Intergenic
950480003 3:13238248-13238270 GGTTGTGTGGAGGAGTGACAGGG - Intergenic
951625074 3:24651396-24651418 AGTTGTGAGCAAAAGAGACAAGG - Intergenic
952726989 3:36597008-36597030 AGTTCTGTGAAGAAGGGAGATGG - Intergenic
953932274 3:47011408-47011430 GGCTGTGTGCAGGAGGAATATGG - Intergenic
954683758 3:52359611-52359633 GGTACTGTGCAGGAGGGACCAGG - Intronic
955441837 3:58964390-58964412 GGTTGTGTGCATGAGTGATAAGG - Intronic
955534202 3:59905518-59905540 AGGTGTGTGCAGGAGGGATGAGG + Intronic
955597429 3:60606835-60606857 AGATGCGGGCAGGAGGGACTAGG - Intronic
962356630 3:134699663-134699685 TGATGTGTACAGGAGGGACCAGG - Intronic
963661684 3:148134385-148134407 AGATGTGTGCAGAAGGCAAAGGG + Intergenic
963693464 3:148535062-148535084 AGTTGGATGGAGGAGGGTCATGG + Intergenic
966641896 3:182201240-182201262 TGTTGTGAGAAGGAGGGAGAAGG + Intergenic
966931419 3:184678139-184678161 AGGTGTGTGGACCAGGGACAGGG + Intronic
968811725 4:2803028-2803050 AGGTGTGTGCAGGAGCTGCATGG + Intronic
968920813 4:3521389-3521411 AGTTCTGTCCAGTAGGGTCACGG - Intronic
969480492 4:7444512-7444534 AGCTGGGTGCAGGAAGAACAGGG + Intronic
973623556 4:52750490-52750512 AGCTGGGTGGAGGAGAGACAGGG - Intronic
977468289 4:97409444-97409466 AGTTGTGTGCAGAAGCTGCAAGG + Intronic
981104887 4:140869472-140869494 CTTAGTGTGCAGTAGGGACACGG - Intronic
982157829 4:152538746-152538768 AGTTGTGTTCGGGAAGGTCATGG - Intergenic
982618606 4:157675285-157675307 AGTTGTGTTCACTAGGGAGAGGG + Intergenic
985574160 5:665871-665893 AGGGGTGGTCAGGAGGGACATGG - Intronic
985661171 5:1157339-1157361 AGGTGTGGGCAGGTGGCACAGGG - Intergenic
985939656 5:3125124-3125146 AGGTGCCTGCAGGAGGGATATGG - Intergenic
986105501 5:4655863-4655885 AGATGTTTGCTGCAGGGACAGGG - Intergenic
986447104 5:7831253-7831275 AATTTTGTGCAGTAGGGACCAGG - Exonic
986798559 5:11236121-11236143 AGTTGTTTACATGATGGACATGG + Intronic
988836426 5:35037104-35037126 GGGTGTGTGCAGGAGGGACGTGG - Intronic
990221512 5:53595728-53595750 AGATTTGTGCAAGAGGGATAAGG - Intronic
992937595 5:81725793-81725815 AGTTGTGGGGAGGAGGCACTAGG + Intronic
993237341 5:85329972-85329994 AGTTATGGGCAGGAGGGAAATGG + Intergenic
994269276 5:97757982-97758004 AGGTGTGTACAGGAGGAAGATGG - Intergenic
994330999 5:98506438-98506460 AGTGGTTTGCAGGATGGACTGGG + Intergenic
997279338 5:132629262-132629284 AGCAGTTTGGAGGAGGGACAGGG - Intronic
997872351 5:137516866-137516888 AGGTGAGTTCAGGAGGGGCAGGG + Intronic
998463050 5:142323652-142323674 GGTTGTGGGCAGGAGAGGCAGGG - Intronic
998484709 5:142491535-142491557 AGTTTTGTCCAGCAGGAACAAGG + Intergenic
999745728 5:154590423-154590445 AGTAGGGTGCAGGAGAGACCAGG - Intergenic
1000237669 5:159377365-159377387 AGTAGTGTGCCGGGGGAACAAGG - Intergenic
1000635696 5:163641381-163641403 AGTTCTCAGCAGTAGGGACATGG + Intergenic
1000883261 5:166721243-166721265 AGTTGGGTGCAGGGAGGAGATGG - Intergenic
1001954640 5:175840685-175840707 AGTTCTTTGCAGGATTGACAGGG + Intronic
1002053213 5:176583729-176583751 AGTTGTGTGCAGGAGGGACAGGG + Intronic
1002092450 5:176813250-176813272 AGTCTTGAGCAGGAGGGACTTGG + Intronic
1002355237 5:178622879-178622901 ACTTGTATGTAGGAGGGAGATGG - Intronic
1002888638 6:1316523-1316545 GGGTGTGTGAAGGAGGGACAGGG - Intergenic
1003290811 6:4776749-4776771 AGTTGCGGGCGGGAGGGGCAGGG - Exonic
1003598518 6:7496536-7496558 AGTTGTGTCTTGGAGTGACACGG + Intergenic
1005233829 6:23736680-23736702 AGATGTGTGATTGAGGGACAAGG - Intergenic
1005583401 6:27253501-27253523 TTTTGAGTACAGGAGGGACAAGG - Intronic
1006784376 6:36655486-36655508 AGTTGTCTGCATGTGGGCCAGGG - Intergenic
1006902580 6:37512700-37512722 AGTTGTGTGGAGGTGGGATGTGG + Intergenic
1007336347 6:41157646-41157668 ATGGGTGTGCAGGAGGGACAGGG - Intergenic
1007947896 6:45842103-45842125 ATTGGTGTGGAGGAAGGACATGG - Intergenic
1008371246 6:50733715-50733737 AGTGATATGCAGGAAGGACAAGG - Intronic
1009960584 6:70516107-70516129 AGTTGTTTGCAGAAGGAAGAGGG + Intronic
1010018383 6:71130951-71130973 AGTGGTGGGCAGGAGGGAAGTGG - Intergenic
1011362816 6:86546634-86546656 AAATGTGTGCAGGAGGGCTAAGG - Intergenic
1012092730 6:94919256-94919278 AGAAGTGTGCTGCAGGGACAGGG - Intergenic
1014127885 6:117797831-117797853 AGTGATGTGCAGAAGGAACAGGG + Intergenic
1015428389 6:133100127-133100149 AATTGTGTGAAGGTGGGAGATGG + Intergenic
1015649857 6:135444512-135444534 GGGTGAGTGAAGGAGGGACAAGG - Intronic
1018618920 6:165712132-165712154 AGTGGTGTGGAGGAGGAAAAGGG + Intronic
1019499261 7:1356182-1356204 GGTTTGGAGCAGGAGGGACATGG - Intergenic
1020142979 7:5622536-5622558 AGGTGTGAGCAGCAGGGACCTGG + Intronic
1021214484 7:17900185-17900207 AGTTGTGTGGAGCTGGGAGAGGG + Intronic
1021612890 7:22475336-22475358 AGGTGCGTGCAGCAGGGACACGG - Intronic
1022728299 7:33000160-33000182 AGTTGTGTTGGGGATGGACATGG + Exonic
1024359365 7:48452591-48452613 ATTTGTGTACAGCAGGGAAATGG - Intronic
1025045351 7:55687857-55687879 AGTTGTGTTGGGGATGGACATGG - Intergenic
1025216516 7:57060882-57060904 AGTCCTGTGCTGGAGGGGCAGGG - Intergenic
1025627267 7:63233332-63233354 AGTCCTGTGCTGGAGGGGCAGGG - Intergenic
1025654864 7:63509848-63509870 AGTCCTGTGCTGGAGGGGCAGGG + Intergenic
1028414044 7:90560883-90560905 AGTTGTGGGAAGGAGGGAATGGG + Intronic
1028623257 7:92847502-92847524 TGTTGTGTGCAGAAGGCAGAGGG - Intergenic
1028782809 7:94756909-94756931 AGTTTGCTGGAGGAGGGACAAGG + Intergenic
1029649187 7:101879284-101879306 AGCTATGTGAAGGGGGGACAGGG - Intronic
1030898670 7:115094244-115094266 AGTTGGGTCCAGGAGTGTCAGGG - Intergenic
1032463125 7:132126409-132126431 CTATGTGTGCAGGAGAGACACGG + Exonic
1033521193 7:142162087-142162109 GGTTATGTGCAGCAGAGACAGGG + Intronic
1037414280 8:18632282-18632304 AGGGTTGAGCAGGAGGGACAAGG - Intronic
1037760964 8:21741271-21741293 AGAAGTTTGCAGGAGGGAAAGGG - Intronic
1038276109 8:26122237-26122259 CTGTGTGTGCTGGAGGGACATGG - Intergenic
1039022656 8:33224656-33224678 AGTTGTGAAAAGGAGGCACATGG - Intergenic
1039845542 8:41323188-41323210 GGGTGTGTGCAGGAGGCCCAGGG - Intergenic
1039977483 8:42379741-42379763 AGGTGTGTGCAAGAGGGAGGAGG + Intergenic
1046882244 8:119321849-119321871 AGTTATGTGGAGGAGTGCCAGGG + Intergenic
1047363976 8:124195473-124195495 AGCTGTGGGCAGGAGGGAGGAGG - Intergenic
1047508138 8:125495956-125495978 AGTGGTGTTCAGGTGGGACTTGG + Intergenic
1047754827 8:127910251-127910273 AGTTGTGTGCGAAAGGTACAGGG + Intergenic
1048035481 8:130673571-130673593 AGTTTTGTGGAGGAGGCACCTGG + Intergenic
1049244015 8:141551850-141551872 TGGTGCCTGCAGGAGGGACATGG - Intergenic
1049290441 8:141798781-141798803 AGTTGTGTGCAGGGGACACGTGG - Intergenic
1049419303 8:142509980-142510002 AGGTCTGTGAAGGAGGGACACGG + Intronic
1049515238 8:143050970-143050992 TTGTGTGTGCACGAGGGACAAGG - Intronic
1049827495 8:144678908-144678930 AGCGTAGTGCAGGAGGGACATGG + Intergenic
1053031402 9:34782268-34782290 AGTAGGGTAGAGGAGGGACAGGG + Intergenic
1056218428 9:84427602-84427624 AGGTGTGTGCAGGAGGGGAGAGG - Intergenic
1056808351 9:89745578-89745600 AGTTGTGGGCATGAGGCAGAGGG - Intergenic
1057789190 9:98111647-98111669 AGTTGTTTTCAGGCTGGACACGG + Intronic
1057839717 9:98476443-98476465 AGTTGTGTGCATGAGTTACCTGG - Intronic
1059974840 9:119704795-119704817 GGATGTGTGCAGGATGGATAGGG - Intergenic
1060578973 9:124726303-124726325 AGTTAGGGGCAGGAGGGAGAAGG - Intronic
1061166690 9:128926943-128926965 AGCTGTGTGAAGGTGGGACCAGG - Intronic
1061802290 9:133119277-133119299 GGGTGTTGGCAGGAGGGACAGGG + Intronic
1062158977 9:135069443-135069465 AGGTGTGAGGAGGAGGGCCAAGG + Intergenic
1062158989 9:135069476-135069498 AGGTGTGAGGAGGAGGGCCAAGG + Intergenic
1062159001 9:135069509-135069531 AGGTGTGAGGAGGAGGGCCAAGG + Intergenic
1062159013 9:135069542-135069564 AGGTGTGAGGAGGAGGGCCAAGG + Intergenic
1186028876 X:5345577-5345599 AGTTGTGTACAGGAAGGAGATGG - Intergenic
1189144857 X:38645188-38645210 AGTTGGCTGGAGTAGGGACAGGG + Intronic
1189870531 X:45378041-45378063 AGTTGTGGGTTTGAGGGACAGGG + Intergenic
1193235143 X:79097465-79097487 AGTGGTGAGCAAGAGGGACATGG - Intergenic
1194543563 X:95204731-95204753 AGTTATCTGCAGCAGGAACATGG - Intergenic
1195727764 X:107935666-107935688 AGTGGGGTGCCGGAGGGAAAGGG - Intergenic
1198857516 X:141033558-141033580 AGAAGTTTGCTGGAGGGACAGGG + Intergenic
1198905180 X:141553813-141553835 AGAAGTTTGCTGGAGGGACAGGG - Intergenic