ID: 1002055123

View in Genome Browser
Species Human (GRCh38)
Location 5:176594335-176594357
Sequence CACCCCAGCCATGGGAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002055123_1002055130 11 Left 1002055123 5:176594335-176594357 CCTGCTCTCCCATGGCTGGGGTG 0: 1
1: 1
2: 3
3: 32
4: 298
Right 1002055130 5:176594369-176594391 TCCTTTTCCCAGGAATCTCTTGG 0: 1
1: 0
2: 6
3: 29
4: 292
1002055123_1002055129 1 Left 1002055123 5:176594335-176594357 CCTGCTCTCCCATGGCTGGGGTG 0: 1
1: 1
2: 3
3: 32
4: 298
Right 1002055129 5:176594359-176594381 CGCAGGTGGATCCTTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002055123 Original CRISPR CACCCCAGCCATGGGAGAGC AGG (reversed) Intronic
900251307 1:1671585-1671607 CATCCCAGTCATGGGCGGGCTGG - Exonic
900252175 1:1676660-1676682 AACCCCAGCACTGGAAGAGCTGG - Exonic
900262585 1:1739518-1739540 AACCCCAGCACTGGAAGAGCTGG - Exonic
900397473 1:2459059-2459081 CAACCCAGCCACCGGGGAGCAGG - Intronic
900524745 1:3123126-3123148 CACCTCATACATGGGACAGCAGG + Intronic
900828902 1:4949795-4949817 CATTCCAGGCATGGAAGAGCAGG - Intergenic
901230296 1:7638148-7638170 GACCCCAGGCAGGAGAGAGCTGG - Intronic
902132193 1:14271804-14271826 TATCCAAGCCATAGGAGAGCAGG + Intergenic
902790634 1:18765484-18765506 CTGCTCAGCCATGGCAGAGCTGG + Intergenic
903225302 1:21891125-21891147 TACCCCAGCCAGGGCAGATCAGG - Intronic
903673053 1:25047738-25047760 CACCCCAGAGCTGGGATAGCTGG + Intergenic
903807819 1:26017869-26017891 CACCCCAGCCCTGGGGATGCTGG - Intergenic
904036837 1:27563626-27563648 CACCCCAGCACTGCCAGAGCCGG + Intronic
904367572 1:30024548-30024570 CACCCCAACCATGGGGGACCTGG - Intergenic
904386178 1:30143619-30143641 CACTCCAGCCATGGGTGAAAGGG - Intergenic
904499656 1:30906898-30906920 CACCCCACTTAGGGGAGAGCTGG + Intronic
904854822 1:33489746-33489768 CATCCCTGCCATGAGAGTGCTGG - Intronic
905929994 1:41780222-41780244 CACCGCAGTGAGGGGAGAGCTGG + Intronic
906315689 1:44785167-44785189 AGCCCCAGCCCTGGGAGACCCGG - Exonic
907187327 1:52619751-52619773 CACTCCAGCAAGGGGAGAGAGGG + Intergenic
912713949 1:111968772-111968794 CAGCCCAGCCAGCAGAGAGCTGG - Intronic
916100348 1:161388865-161388887 CACCCCTTCCATGGTAGGGCCGG + Intergenic
916316051 1:163448932-163448954 CACTCTAGCCTTGGGAGAACAGG - Intergenic
916731491 1:167571099-167571121 TACCCCAGTCATGGGATTGCTGG + Intergenic
918050496 1:180968865-180968887 CATGCCAGCCATGGGGAAGCAGG - Intergenic
918060989 1:181061048-181061070 CATGCCAGCCATGGGGAAGCAGG - Exonic
919927745 1:202201068-202201090 CTCCCCATCCCTGGGAGATCAGG + Intronic
920454848 1:206092932-206092954 CACCCCAGCCTTTAAAGAGCAGG + Intronic
920745515 1:208624355-208624377 GAGGCCAGCCATGAGAGAGCAGG - Intergenic
921285389 1:213604784-213604806 GATCCCAGCCATTGGAGACCTGG + Intergenic
923410889 1:233708020-233708042 CATCCCTGCCTTGGGAGACCAGG + Intergenic
923651370 1:235877237-235877259 CACACCAGCCATGACAGAGAGGG + Intronic
923663913 1:235982115-235982137 AACCCCAGCCTGGGGAGAACAGG + Intronic
923683896 1:236141435-236141457 CACCCTTGTCTTGGGAGAGCTGG - Intergenic
923913223 1:238472748-238472770 CAGCCCTGCCTTGGGAGACCAGG - Intergenic
924470208 1:244336666-244336688 CACCTCAGCCCTGGGAGGCCTGG + Intergenic
924710833 1:246528884-246528906 TACCCCAGCCCTGGGAAAACAGG + Intergenic
1062828393 10:588287-588309 CACACCAGCCACAGGAGGGCAGG + Intronic
1064989389 10:21242935-21242957 CACCCCTGCCTTGGGAAATCAGG + Intergenic
1065131247 10:22622406-22622428 CAGCCCAGCCCTGTGTGAGCTGG - Intronic
1067047957 10:42996511-42996533 CACCCCACCCATGGGAGGATGGG - Intergenic
1068264251 10:54626451-54626473 CACTCCAGCCATGGGTGAAAGGG + Intronic
1068855394 10:61792574-61792596 TAGCCCAGCCTTGGGAGATCAGG + Intergenic
1069812446 10:71172390-71172412 CACCTCAGCCTTGTAAGAGCAGG + Intergenic
1069913122 10:71771889-71771911 CAGCCCAGCCAAGTGAGGGCAGG + Intronic
1073139884 10:101240028-101240050 CACCCCATCCCTGGGAGTGGGGG + Intergenic
1074854285 10:117462025-117462047 CACCCCGCCCCTGGCAGAGCTGG + Intergenic
1076043347 10:127270114-127270136 CACCCCTGCCACAGGAGAGAAGG - Intronic
1077522824 11:3046383-3046405 CACCCGAGCCCTTGGAGAGAAGG + Intronic
1077534697 11:3118072-3118094 CATCCTAGCCATGAGAGATCAGG + Intronic
1079610873 11:22431308-22431330 CACCCCAGCCCTGGAACGGCAGG - Intergenic
1080875105 11:36267626-36267648 TATCCCAGCCATGGGAAAGAGGG - Intergenic
1081629838 11:44681629-44681651 CACCCCACCCATGGGGCAGATGG - Intergenic
1081873245 11:46392487-46392509 CATCCCAGGGCTGGGAGAGCAGG - Intergenic
1083270305 11:61568999-61569021 CACCCCAGCCTTGGGGAAGTGGG - Intronic
1083294686 11:61708925-61708947 CACCCCAGGCAGGGCAAAGCTGG - Intronic
1084707840 11:70826019-70826041 CAACCCCGGGATGGGAGAGCCGG + Intronic
1085328224 11:75625028-75625050 CACCAGAGCCTGGGGAGAGCAGG + Intronic
1089375794 11:117993692-117993714 CGCCCCTGTTATGGGAGAGCTGG + Intronic
1090291962 11:125553594-125553616 CCCCCCAGCCATGGAAGAAGAGG + Intergenic
1092197806 12:6560420-6560442 GACCTCTGCCATGGCAGAGCAGG - Intronic
1092230122 12:6771487-6771509 CAGCCCAGCCCAGGGAGAGTTGG - Intergenic
1093181936 12:15976530-15976552 AACCACAGACAAGGGAGAGCAGG - Intronic
1096867976 12:54576493-54576515 CACCTTAGCCCTGGGAGTGCAGG - Intronic
1100334818 12:93619184-93619206 CACCACAGCCATGGCAACGCAGG + Intergenic
1101942608 12:109111154-109111176 CACCGCAGCCAGGGGAGGGTTGG - Intergenic
1101964275 12:109271659-109271681 CTCCCAACCCATGGGAGAGGTGG - Intergenic
1102036159 12:109771589-109771611 CACCCCAGCCCCTGGGGAGCAGG + Intergenic
1102190707 12:110985842-110985864 TATCCCAGCCATGGGAGAGCTGG - Intergenic
1102260152 12:111438432-111438454 CACCCCAGCCCTGAGAGCACTGG + Intronic
1106400790 13:29428423-29428445 CATCCCCGCCAGGGGAGGGCTGG + Intronic
1110249933 13:73370341-73370363 CAAACCATCCATGAGAGAGCTGG - Intergenic
1111253550 13:85638386-85638408 CACGCCTGCCAAGGGTGAGCAGG + Intergenic
1111559960 13:89932353-89932375 CACTCCAGCCTGGGGAGAGAGGG - Intergenic
1112887592 13:104193433-104193455 CACCCCAGCCATGGCTGAAAGGG + Intergenic
1114431178 14:22662620-22662642 CACTCCAGCCTGGGGACAGCAGG - Intergenic
1114526114 14:23367686-23367708 GACCCCAGCCCTGGGGGACCTGG + Intergenic
1115963899 14:38865337-38865359 AACCCCAGCCTTGGGAAAGGGGG - Intergenic
1119438163 14:74611505-74611527 GTCCCCAGGCGTGGGAGAGCCGG + Exonic
1119725223 14:76918244-76918266 CACCCCAGCCAAGGCTCAGCTGG + Intergenic
1119777242 14:77256860-77256882 CACCCCAGCCATGGGCCATACGG + Exonic
1121255085 14:92525225-92525247 GACCCCAGCCACAGAAGAGCCGG + Intronic
1122082527 14:99275136-99275158 CACCCCAGGCAGGCGAGAGGGGG + Intergenic
1122217180 14:100212229-100212251 CACCCCAGCCAAGGGAGACTTGG - Intergenic
1122786739 14:104167455-104167477 GGCCCCTGCCATGGGAAAGCGGG + Intronic
1122982608 14:105198443-105198465 GACCCCAGTCAGGGGAAAGCCGG + Intergenic
1202840317 14_GL000009v2_random:115103-115125 CACACCTGCCAAGGGCGAGCTGG - Intergenic
1202909700 14_GL000194v1_random:105300-105322 CACACCTGCCAAGGGCGAGCTGG - Intergenic
1124597539 15:31103081-31103103 CCTCCCAGCCATGGCAGTGCCGG - Intronic
1126103860 15:45135323-45135345 CACCCCAGCCAGGTGGGACCTGG + Intronic
1129824182 15:78624006-78624028 CACCGCAGTCATGGAGGAGCAGG + Intergenic
1129938039 15:79466928-79466950 CAGCCCAGCCAGGAGGGAGCTGG + Intronic
1131731245 15:95283668-95283690 AGCCCCAGAAATGGGAGAGCTGG + Intergenic
1132111227 15:99103584-99103606 CACCCCAACCAAGGGTCAGCTGG + Intronic
1132573249 16:653239-653261 CACTCCAGCCCAGGGAGAGGGGG - Intronic
1133104079 16:3495473-3495495 CCCCCTAGGCAGGGGAGAGCAGG - Intronic
1134126008 16:11616441-11616463 CACTCCAGCCATGGGTGACAGGG + Intronic
1134392809 16:13835271-13835293 CACCCCAGGGATGTGGGAGCCGG - Intergenic
1135135363 16:19883120-19883142 TTCCCCAGCCCCGGGAGAGCAGG + Intronic
1137330700 16:47492615-47492637 CACCCCAGCCTTGGCAGGGAGGG + Intronic
1137674752 16:50298792-50298814 GCCCCCAGCCAGGAGAGAGCCGG + Intronic
1137926574 16:52546913-52546935 CACGCGAGCCGCGGGAGAGCGGG + Exonic
1138125112 16:54432434-54432456 CACCCCGGCCCTGAGTGAGCAGG + Intergenic
1138515972 16:57535857-57535879 CACAAGAGCCCTGGGAGAGCGGG + Intronic
1139475521 16:67200740-67200762 CAGCCCAGCCCTGGGCCAGCTGG + Exonic
1141495232 16:84405172-84405194 CATTCCAGCCATGGGCCAGCCGG - Exonic
1141704818 16:85658922-85658944 CACCGCAGCCAGGGGAGGCCAGG - Intronic
1143781613 17:9232266-9232288 CACCCCAGCTGGGGCAGAGCAGG + Intronic
1146002713 17:29140671-29140693 CACCCCAGCTCCGGGACAGCTGG + Intronic
1147988528 17:44319956-44319978 CTCCCCATCCGTGGGAGAGACGG + Exonic
1148218043 17:45844693-45844715 CCCCCCAACCCTGGGAGACCAGG - Intergenic
1148344616 17:46894995-46895017 CATCCCAGCCACTGGAGAGCCGG + Intergenic
1148722509 17:49763965-49763987 CAGCCCAGCCCGGGGGGAGCCGG + Exonic
1148868107 17:50639612-50639634 CACCCCAGCAATGGCATACCAGG - Intronic
1150631732 17:66884915-66884937 GACCCCAGCCAAGGGAGATGAGG + Intronic
1150822502 17:68446720-68446742 CACCCAATCCCTGGGATAGCGGG + Intronic
1151182182 17:72337276-72337298 AACGCCAGCCAAGGAAGAGCAGG - Intergenic
1151290617 17:73147244-73147266 AACCCCAACCTTGGGAAAGCAGG - Intergenic
1152864086 17:82711944-82711966 CACACCGGCTATGGTAGAGCGGG + Intergenic
1153961941 18:10147519-10147541 CACCCTAACCATGGAGGAGCTGG - Intergenic
1157023868 18:43819393-43819415 CACCACAGCAATGAGACAGCAGG + Intergenic
1157934474 18:51858112-51858134 CATCCCAGCCATGGCAAAGCAGG + Intergenic
1158106883 18:53895501-53895523 TACCAGAGCCATGGGACAGCTGG - Intergenic
1160385792 18:78495444-78495466 GACCACAGGCATGGGACAGCCGG + Intergenic
1161800150 19:6412879-6412901 CAGCCCATCCATGGGAACGCCGG + Intergenic
1161981412 19:7632306-7632328 CACCCCAGCCAGGAGGGAACAGG - Intronic
1162779185 19:12997719-12997741 CACCCAAGCCATGGGGGAGCAGG - Intronic
1163548720 19:17953329-17953351 GACCCTAGCCTTGGGAGGGCAGG - Intronic
1163698937 19:18777584-18777606 CAGCCCAGCCCTGGGCGGGCGGG - Exonic
1163763500 19:19149729-19149751 AACCCCAGCCATAGGGGAGATGG - Intronic
1165384180 19:35500800-35500822 CACCCATGCCGTGGGAGAGTTGG + Intronic
1168406786 19:56114629-56114651 CAGCCCTGCCATGGGAAAGGTGG - Intronic
1168561713 19:57390062-57390084 CAGCCCAGCCAGGGAAGAGCGGG - Exonic
1168564387 19:57411354-57411376 CAGCACAGCCAGGGAAGAGCGGG - Exonic
1202632736 1_KI270706v1_random:15448-15470 CACACCTGCCAAGGGTGAGCTGG + Intergenic
925055440 2:853581-853603 CACCCCCACCATGGGGAAGCAGG - Intergenic
925459747 2:4050176-4050198 CACCCTACCCATGAGAGTGCTGG - Intergenic
927633028 2:24790855-24790877 GGCGCCAGCCATAGGAGAGCTGG - Intronic
927639589 2:24838280-24838302 CACCCTTCCCAAGGGAGAGCTGG - Intronic
927940470 2:27100131-27100153 CTCCCCAGCCAGGGCAGAGCTGG - Exonic
928113694 2:28529792-28529814 CAGCCCAGCCATGCCAGAGTTGG - Intronic
929058741 2:37901900-37901922 CACACCAACCAAGGGAGAGTTGG - Intergenic
929920806 2:46170015-46170037 AGCCCCAGCCATGTGAGAGCAGG + Intronic
930024832 2:47023690-47023712 CCCCTGAGCCCTGGGAGAGCAGG - Intronic
930762373 2:55050288-55050310 CCCTCCAGCCATGGAAGACCTGG - Exonic
931006100 2:57850824-57850846 CTGCCCAGCCATGGGAGGGTGGG + Intergenic
932837048 2:75047483-75047505 CACCCCATCTATGGAAGAGAAGG - Exonic
933890736 2:86767095-86767117 CACTCCAGCCAGGGGACAGAGGG - Intronic
935079446 2:99777868-99777890 CACCCTGGCCCTGGGAGCGCAGG + Intronic
935099859 2:99983230-99983252 CACCTCTGCCATTGGATAGCTGG - Intronic
936996755 2:118423929-118423951 CACCCCTGCCCTGGGAGGACTGG - Intergenic
937058959 2:118967391-118967413 AACTGCAGCCATAGGAGAGCTGG + Intronic
938246741 2:129782803-129782825 CACCCCCACCCTGGGAGAGAGGG - Intergenic
938500122 2:131827960-131827982 CACACCAGCCATGGGCGAGAAGG + Intergenic
938502725 2:131839735-131839757 AATCCCAGTAATGGGAGAGCTGG - Intergenic
941049647 2:160718431-160718453 CACTCCAGCCGTGACAGAGCAGG - Intergenic
941635642 2:167932374-167932396 GAGGCCAGCAATGGGAGAGCTGG - Intergenic
942186195 2:173427173-173427195 GCCCCCAGCCATGGCAGTGCTGG + Intergenic
944808862 2:203308612-203308634 CACTCCAGCCATGGGTGAAAGGG + Intergenic
946229429 2:218282413-218282435 CTCCCCAGCCATAGGAAAGCAGG + Intronic
946242411 2:218364738-218364760 CAGCTCACCCATCGGAGAGCAGG - Exonic
946400657 2:219466713-219466735 CACCCCAGCCCTGACAGAGAAGG - Intronic
948726286 2:239936024-239936046 CTGCCCAGCCCTGGGGGAGCCGG - Intronic
948888521 2:240895955-240895977 CACCTCAGCCATGGCCGTGCAGG - Exonic
948967193 2:241392058-241392080 CACCTCAGCCTTGCGAGAGAAGG - Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1172878117 20:38178504-38178526 CAACCCTGCCATTGTAGAGCTGG + Intergenic
1173150534 20:40563049-40563071 GACCCCAGGCGTGGGAGAGTAGG + Intergenic
1173416619 20:42862526-42862548 CACCCTGGCTATGGGAGAGGTGG - Intronic
1175158090 20:56987587-56987609 CACCACAGTCATGAGAGTGCTGG + Intergenic
1175459745 20:59143517-59143539 CACTCCAGCCATGGCAGGCCTGG + Intergenic
1175577779 20:60075499-60075521 CACCTCAGCCTGGGAAGAGCTGG - Intergenic
1176201482 20:63862798-63862820 CCCACCAGCCATGGGAAGGCGGG - Exonic
1176629047 21:9120007-9120029 CACACCTGCCAAGGGCGAGCTGG - Intergenic
1176644951 21:9341328-9341350 CACACCTGCCAAGGGTGAGCTGG + Intergenic
1177029586 21:15966440-15966462 GATCCCAGCCTTGTGAGAGCTGG - Intergenic
1179981152 21:44896645-44896667 CATCCCTGTCTTGGGAGAGCTGG + Intronic
1180115854 21:45704484-45704506 CGCCTCTGCCAGGGGAGAGCAGG - Intronic
1180368001 22:11957906-11957928 CACACCTGCCAAGGGTGAGCTGG - Intergenic
1180378090 22:12113430-12113452 CACACCTGCCAAGGGTGAGCTGG + Intergenic
1180419415 22:12799851-12799873 CACACCTGCCAAGGGTGAGCTGG - Intergenic
1180636197 22:17264792-17264814 CAGCCCAGCCAGAGGTGAGCTGG + Intergenic
1180762816 22:18222418-18222440 GACCGCAGCCAGGGGAGAGCCGG + Intergenic
1180772851 22:18402190-18402212 GACCGCAGCCAGGGGAGAGCCGG - Intergenic
1180804209 22:18651745-18651767 GACCGCAGCCAGGGGAGAGCCGG - Intergenic
1180806544 22:18717671-18717693 GACCGCAGCCAGGGGAGAGCCGG + Intergenic
1180963102 22:19771241-19771263 CACCCAAGCCTAGGGAGGGCAGG + Intronic
1181217490 22:21343453-21343475 GACCGCAGCCAGGGGAGAGCCGG + Intergenic
1181856560 22:25785366-25785388 CACACCAGCCCTGGCAGGGCAGG - Intronic
1182318490 22:29463502-29463524 CAGCCCTGCCATGGGTGGGCTGG - Intergenic
1182318491 22:29463503-29463525 CAGCCCACCCATGGCAGGGCTGG + Intergenic
1183086536 22:35490542-35490564 GAACCCAGGCATGGGAGAGATGG + Intergenic
1183360916 22:37383056-37383078 CACCACAGCGAAGGAAGAGCAGG - Intronic
1183476679 22:38039513-38039535 CACCCCCGCCTTGTGAGAGCCGG + Intronic
1183745557 22:39689646-39689668 CACCCGGGCCATGGGCCAGCAGG - Exonic
1184041209 22:41945173-41945195 ACCCCCAGCCAAGGGAAAGCTGG - Intronic
1184259871 22:43308638-43308660 CAGCCCAGCGGAGGGAGAGCTGG + Intronic
1203234686 22_KI270731v1_random:143178-143200 GACCGCAGCCAGGGGAGAGCCGG - Intergenic
949641240 3:6037591-6037613 CACCCCAGCCATGGCTGAAAGGG - Intergenic
950106987 3:10394640-10394662 AAGGCCAGGCATGGGAGAGCCGG - Intronic
952326194 3:32322655-32322677 CACCCCAGCCATGGCATAGATGG + Intronic
952793461 3:37218352-37218374 CACACCAGCTATGGCAGAGTGGG - Intergenic
952861774 3:37818777-37818799 CTCCCCAGCCCTGTGAGTGCAGG + Intronic
953494041 3:43371400-43371422 CACCCCAGCCTTGGGTGTGCAGG + Intronic
953623703 3:44553705-44553727 CAACCCAGTCATGGTAGATCGGG + Intergenic
953702836 3:45210165-45210187 CACCCCAGAGAAAGGAGAGCAGG + Intergenic
954106001 3:48410144-48410166 GCCCCCACCCCTGGGAGAGCTGG - Intronic
954411324 3:50372462-50372484 GGCCCCAGCCATTGAAGAGCAGG - Intronic
954746735 3:52791693-52791715 CACCCCACCCATGTGACACCTGG - Intronic
956267928 3:67418638-67418660 CTTCCTAGCCATGGGAGAACAGG + Intronic
956384308 3:68700830-68700852 CACCCCAGGTAGGGGAGAGGAGG - Intergenic
957095379 3:75772701-75772723 CACGCCTGCCAAGGGCGAGCTGG - Intronic
958593499 3:96190529-96190551 CACACCTGCCATGGGTGAGCTGG - Intergenic
960147894 3:114222325-114222347 AACACCATCCATGGGAGAGCAGG - Intergenic
960613804 3:119579488-119579510 GACCACAGCCAGGCGAGAGCCGG + Exonic
961398060 3:126611570-126611592 GAACCCAGCCATGGGAGAGCAGG + Intronic
961556937 3:127702254-127702276 CACTCCAGCCAGGCTAGAGCTGG - Intronic
961657827 3:128453094-128453116 CAGCCATGCCGTGGGAGAGCCGG + Intergenic
961748528 3:129081626-129081648 AACCCCAGCCTTGGGAAAGCAGG + Intergenic
967463813 3:189778967-189778989 CACACGAGCTATGGGAAAGCTGG - Intronic
967630392 3:191738131-191738153 GACACCAGCCAAGGGAGTGCTGG - Intergenic
1202741940 3_GL000221v1_random:63740-63762 CACACCTGCCAAGGGTGAGCTGG - Intergenic
968625074 4:1623343-1623365 CACCGCAGCCCCGGGAGAGGAGG + Intronic
969663133 4:8542018-8542040 CACCCCAAACACGAGAGAGCAGG - Intergenic
973362371 4:49177422-49177444 CACACCTGCCAAGGGTGAGCTGG + Intergenic
973398728 4:49619439-49619461 CACACCTGCCAAGGGTGAGCTGG - Intergenic
974083288 4:57234344-57234366 CCCCCCTGCCTTTGGAGAGCAGG - Intergenic
975498441 4:75058731-75058753 CACACCTGCCAAGGGCGAGCTGG - Intergenic
976453388 4:85218222-85218244 CACCCCAGCCATGAGGGATCCGG - Intergenic
985159939 4:187034052-187034074 CACTCCAGCCATGGCTGAGAGGG + Intergenic
1202759707 4_GL000008v2_random:98895-98917 CACACCTGCCAAGGGTGAGCTGG + Intergenic
985520533 5:372169-372191 CACCCCAGCCCTGGGGGAGGAGG - Intronic
985621295 5:957516-957538 CACCCCAGCCATGCTGGGGCTGG + Intergenic
985863743 5:2495373-2495395 CACCCCACACAGGGGAGAACTGG - Intergenic
986178041 5:5368600-5368622 CCCCCCATCCAGGGGAGAGGGGG + Intergenic
986754593 5:10823857-10823879 CACTGCAGCAATGGCAGAGCAGG + Intergenic
990205781 5:53427593-53427615 CACCCCACCCTTAGGAGGGCAGG + Intergenic
990609233 5:57441066-57441088 CACCTCAGGCAGGGCAGAGCAGG - Intergenic
990726986 5:58766851-58766873 CACCCCAGCCAGGAGACATCTGG + Intronic
992199694 5:74370932-74370954 CAGCCCAGCCAGGGGAGAACTGG + Intergenic
992426492 5:76663050-76663072 GACCCCAGCTATGGGAGAATGGG + Intronic
992555785 5:77901748-77901770 CCCCTCAGCCATGGAAGAACAGG - Intergenic
995083034 5:108076267-108076289 CACCCCAGCCAGGGAAGATAGGG - Intronic
995702078 5:114947475-114947497 CACCCCTGCCAGTAGAGAGCAGG + Intergenic
995759868 5:115551754-115551776 CTCCCCAGGCCTGGGAGAGGAGG - Intergenic
996096043 5:119400338-119400360 CACCCCAGCCTTGGGAGTCCAGG + Intergenic
1001277297 5:170360065-170360087 CACCACAGCCCTGGGAGAAGTGG + Intronic
1002029338 5:176416449-176416471 CACCCGAGCCGCGGGGGAGCCGG + Exonic
1002055123 5:176594335-176594357 CACCCCAGCCATGGGAGAGCAGG - Intronic
1003030293 6:2595544-2595566 CTCCACAACCATGGGAGAGCAGG - Intergenic
1005431109 6:25757819-25757841 CACCCCTGACATGGGAGGACTGG - Intronic
1006047230 6:31308266-31308288 CCCCCCATCCCTGGGAGAACCGG + Intronic
1006922212 6:37634341-37634363 GACCCCCGCCAGGGGAGACCAGG - Exonic
1007739464 6:44002106-44002128 CACCCCAGACATAGGAAAGCAGG + Exonic
1015938858 6:138429836-138429858 CACCCCAGCTACAGAAGAGCAGG + Exonic
1016176289 6:141081291-141081313 CACCCCAGCCATGGCTGAAAGGG + Intergenic
1017717268 6:157221909-157221931 CCCCCCAGCCCTGGGAGCCCGGG + Intergenic
1018182493 6:161236467-161236489 CACCCTAGGGATGGGAGTGCAGG + Intronic
1018450235 6:163900974-163900996 TACCCCGGCCCTGGGAGAGCTGG - Intergenic
1019083706 6:169454832-169454854 CAGCCCAGCCATGGATGTGCAGG - Intergenic
1019453893 7:1114650-1114672 TCCCTCACCCATGGGAGAGCTGG - Intronic
1021540209 7:21748848-21748870 CTCCCCAACCACGGGAGAGCGGG + Intronic
1021558154 7:21942737-21942759 TACCCCATCCATAGCAGAGCAGG - Intronic
1021589164 7:22242105-22242127 TAGCCCAGCCAAGGGAGATCAGG - Intronic
1023200618 7:37693614-37693636 CATCCCAGACTTGTGAGAGCAGG + Intronic
1024030696 7:45457229-45457251 CACTCCAGAAATGGGAGTGCGGG + Intergenic
1024295197 7:47836233-47836255 CGACCCATCCATGGGACAGCCGG - Intronic
1024995552 7:55271005-55271027 CACCCCACCCCTGGGAGATGAGG + Intergenic
1027440630 7:78215696-78215718 AACCCCAGCCATGGGAATGGAGG + Intronic
1027443567 7:78246188-78246210 CAGCTCAGACATGGGGGAGCTGG - Intronic
1028138331 7:87245670-87245692 CACTCCAGCCATGGCAGAAAGGG + Intergenic
1028432780 7:90766920-90766942 CACTGCAGGCAAGGGAGAGCTGG - Intronic
1029123701 7:98283885-98283907 CCCCCCAGCCCTGGGATATCTGG - Intronic
1029409172 7:100397901-100397923 AACCCCAGCCAGGTGAGTGCTGG + Exonic
1029677480 7:102080272-102080294 CACCCCGGTCATGGCAAAGCGGG - Intronic
1029678877 7:102093577-102093599 CACCCCATACATTGCAGAGCGGG + Intronic
1032783719 7:135184592-135184614 CACCCCAGCCAGGGAGGAGAGGG + Exonic
1033832531 7:145271100-145271122 CAGGCCAGCCACGGGAGAGAAGG - Intergenic
1034356044 7:150451351-150451373 CTGCTCAGCCATGGGAGAGGAGG + Intronic
1035335832 7:158126523-158126545 CACACCAGCCCCCGGAGAGCGGG + Intronic
1035335858 7:158126610-158126632 CACACCAGCCCCCGGAGAGCGGG + Intronic
1035335884 7:158126697-158126719 CACACCAGCCCCCGGAGAGCGGG + Intronic
1035831640 8:2701240-2701262 CAAACCAGCCGTGGGAGAGACGG + Intergenic
1037581042 8:20246125-20246147 CACCGCAGCGAGGGGAGAGGAGG + Intergenic
1037683832 8:21120745-21120767 ACCCCCATCCATGGCAGAGCTGG + Intergenic
1037854870 8:22364466-22364488 CACCTCAGCTACGGGAGATCTGG + Intergenic
1039185054 8:34907446-34907468 CACCCCAGCAGGGGGATAGCTGG + Intergenic
1039551341 8:38445297-38445319 CACCCCAGGCCAGGGAGAACGGG - Intronic
1043382960 8:79722658-79722680 GAGCCCAGCAATGGGAAAGCAGG + Intergenic
1044106935 8:88221076-88221098 AATACCAGCCATGGTAGAGCTGG + Intronic
1047179896 8:122577050-122577072 CACCCCAGCTGTGGGAGGGCAGG + Intergenic
1047282202 8:123455457-123455479 CACTCCAGCCAGGCGAGAGTGGG - Intronic
1047295581 8:123567862-123567884 GACCCCAGCTCTTGGAGAGCAGG - Intergenic
1048205586 8:132412728-132412750 CTCCCCTGCCCTGGGACAGCAGG + Intronic
1048250665 8:132864339-132864361 CACCCCAGGCTATGGAGAGCTGG - Intergenic
1048269271 8:133015560-133015582 TACCACTGCCATGGGAAAGCAGG + Intronic
1049448932 8:142648455-142648477 CACTCCAGCCATGGCTGAGAGGG + Intergenic
1049600647 8:143505864-143505886 CACCACAGGCATGGGTGGGCAGG - Intronic
1049616137 8:143576523-143576545 CGCCCTGGCCCTGGGAGAGCTGG - Exonic
1049691994 8:143965551-143965573 GACCCCAGCGGTGGGAGATCTGG + Intronic
1049780816 8:144428068-144428090 CGCCCCAGCCGAGGAAGAGCCGG + Intronic
1052791155 9:32876714-32876736 GATCCCAACCATGGGAGGGCCGG + Intergenic
1056580561 9:87886072-87886094 CACCCCAGGCTTGGGACAGGGGG - Exonic
1056595134 9:88001876-88001898 CACCCCAGCCATGGCTGAAAGGG + Intergenic
1056786270 9:89594747-89594769 CACCCCCGCCATGGCCCAGCAGG + Intergenic
1057433184 9:95014357-95014379 CACCTCAGCCCTGGAGGAGCTGG - Intronic
1057521501 9:95764086-95764108 CTCCCCAGGCATTTGAGAGCAGG - Intergenic
1057867265 9:98691466-98691488 CCCCCCAGTCAACGGAGAGCTGG - Intronic
1058894885 9:109390993-109391015 CACAACAGCCATGGGAGGGCAGG - Intronic
1059430128 9:114245018-114245040 CACCCCAGCCACCCGTGAGCTGG + Intronic
1060103240 9:120857857-120857879 CACCCCAGCCTGGAGAAAGCTGG + Exonic
1060890720 9:127186535-127186557 CACCCCAGGCTTGGCAGGGCAGG + Intronic
1061059795 9:128244698-128244720 CACCGCCGCCACTGGAGAGCTGG - Intronic
1061866510 9:133494179-133494201 GACCCGGGACATGGGAGAGCGGG + Intergenic
1061921478 9:133784858-133784880 CACCCCAGCCATCCAACAGCGGG - Intronic
1062395471 9:136350960-136350982 CACCCCAGCCACGGGAGAGCTGG + Intronic
1203751891 Un_GL000218v1:87689-87711 CACACCTGCCAAGGGCGAGCTGG - Intergenic
1203710570 Un_KI270742v1:93664-93686 CACACCTGCCAAGGGTGAGCTGG - Intergenic
1203540483 Un_KI270743v1:83790-83812 CACACCTGCCAAGGGTGAGCTGG + Intergenic
1186017612 X:5215229-5215251 CACCCCAAACATGGGGGTGCTGG - Intergenic
1186425943 X:9464782-9464804 CACCCTAGGCGTGGGGGAGCGGG + Intronic
1186435988 X:9543518-9543540 CAGCCCACCCATGGGAGGCCAGG + Intronic
1186844295 X:13515827-13515849 CCACCCAGGCATGTGAGAGCTGG + Intergenic
1189673407 X:43436876-43436898 CACCCCTGCCATTGGAGATGGGG - Intergenic
1189845976 X:45138920-45138942 CACCCCATCCACAGGGGAGCAGG - Intergenic
1192522462 X:71814665-71814687 CACCCCAGCCATGGAGAGGCCGG + Intergenic
1193085870 X:77447665-77447687 CGGCCCAGCCATGGCAGAGGTGG + Exonic
1193153428 X:78148059-78148081 CACTCCAGCCATGGGTGAAAGGG + Intergenic
1193779163 X:85682407-85682429 TTCCTCAGGCATGGGAGAGCAGG + Intergenic
1194842012 X:98754353-98754375 CAGCTCAGCCATAGTAGAGCAGG - Intergenic
1196221498 X:113116404-113116426 CATCCCAGGCATGACAGAGCAGG + Intergenic
1196982663 X:121232086-121232108 CACCACAGCAGTGGCAGAGCAGG + Intergenic
1198035167 X:132794830-132794852 CACCTCAGACATGGTAGAGCTGG + Intronic
1200147257 X:153932688-153932710 GACCCCAGCTGGGGGAGAGCCGG + Intronic
1201165548 Y:11205309-11205331 CACACCTGCCAAGGGCGAGCTGG - Intergenic