ID: 1002058810

View in Genome Browser
Species Human (GRCh38)
Location 5:176614027-176614049
Sequence CAGCTCCTTGGCTGGCGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002058806_1002058810 -1 Left 1002058806 5:176614005-176614027 CCAGAAGATAAACAAGTGCCTGC No data
Right 1002058810 5:176614027-176614049 CAGCTCCTTGGCTGGCGCCCAGG No data
1002058805_1002058810 18 Left 1002058805 5:176613986-176614008 CCATACACACTCGTACGCACCAG No data
Right 1002058810 5:176614027-176614049 CAGCTCCTTGGCTGGCGCCCAGG No data
1002058804_1002058810 29 Left 1002058804 5:176613975-176613997 CCACTGGGGAGCCATACACACTC No data
Right 1002058810 5:176614027-176614049 CAGCTCCTTGGCTGGCGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002058810 Original CRISPR CAGCTCCTTGGCTGGCGCCC AGG Intergenic
No off target data available for this crispr