ID: 1002060091

View in Genome Browser
Species Human (GRCh38)
Location 5:176620838-176620860
Sequence TTCCTCCTGCATCACCGGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002060083_1002060091 13 Left 1002060083 5:176620802-176620824 CCTGGGCCCCTACGCCTCTGGCT 0: 1
1: 0
2: 1
3: 11
4: 220
Right 1002060091 5:176620838-176620860 TTCCTCCTGCATCACCGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 146
1002060085_1002060091 6 Left 1002060085 5:176620809-176620831 CCCTACGCCTCTGGCTCATACTC 0: 1
1: 0
2: 1
3: 14
4: 109
Right 1002060091 5:176620838-176620860 TTCCTCCTGCATCACCGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 146
1002060086_1002060091 5 Left 1002060086 5:176620810-176620832 CCTACGCCTCTGGCTCATACTCC 0: 1
1: 0
2: 3
3: 29
4: 224
Right 1002060091 5:176620838-176620860 TTCCTCCTGCATCACCGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 146
1002060084_1002060091 7 Left 1002060084 5:176620808-176620830 CCCCTACGCCTCTGGCTCATACT 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1002060091 5:176620838-176620860 TTCCTCCTGCATCACCGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 146
1002060087_1002060091 -1 Left 1002060087 5:176620816-176620838 CCTCTGGCTCATACTCCTGATAT 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1002060091 5:176620838-176620860 TTCCTCCTGCATCACCGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002060091 Original CRISPR TTCCTCCTGCATCACCGGGA TGG Exonic
900652867 1:3739152-3739174 TTCCTTGGGCATCACCGGGCGGG - Intergenic
901290772 1:8122618-8122640 ATCCTCCTGCATAACAGGAAAGG + Intergenic
901459289 1:9382166-9382188 TTCATTCTGCATCGCCCGGAAGG - Intergenic
903500703 1:23798806-23798828 TTCCACCTCCACCACCGGGCGGG - Intronic
904550347 1:31311610-31311632 TTCCTGCTGCATCCTCTGGAGGG + Intronic
905360493 1:37416158-37416180 TTCCTCCTACACCACGGGGTAGG - Intergenic
905860589 1:41348434-41348456 TTCCTCCTTCTTCACAGGGCTGG - Intergenic
914335306 1:146709573-146709595 TTCCTCTTGAGTCACAGGGAAGG - Intergenic
915038069 1:152945213-152945235 TTCCCCCTGCATCCCCAGCATGG + Intergenic
915276562 1:154792833-154792855 TTCTGCCTGCATCACAGGCAAGG - Intronic
916172909 1:162014581-162014603 TTCCTCCTGCAGAACCGAGCTGG + Intronic
916785853 1:168086582-168086604 TTGCTCTTGCACCACCTGGAGGG + Intronic
924145029 1:241064824-241064846 CTCCTCCTTCATGACAGGGATGG - Intronic
924749575 1:246873365-246873387 TTTCTCCTGCATCACAGCAAAGG + Intronic
924749581 1:246873438-246873460 TTTCTCCTGCATCATAGCGAAGG + Intronic
924749587 1:246873511-246873533 TTTCTCCTGCATCACAGTGAAGG + Intronic
1063958745 10:11288575-11288597 CTCCTGCTGCATCACCTGCAAGG - Intronic
1064585551 10:16836561-16836583 TTCCTCCTGCCCCTCTGGGAAGG - Intronic
1070286532 10:75087718-75087740 TTCCTCCTGCTTGGCAGGGAGGG + Intergenic
1072324168 10:94280259-94280281 TTTCTCCTGCACCACCGGCAGGG + Intronic
1074369258 10:112886296-112886318 TATCTCCTGCATCTCCTGGACGG + Intergenic
1074435727 10:113432581-113432603 TTCCTCCTGGATAGACGGGAAGG - Intergenic
1076324313 10:129609338-129609360 TTCCACCTCCATCATCCGGATGG - Intronic
1076542214 10:131221257-131221279 TTCCTCCTGCCTTTCCTGGACGG - Intronic
1076731117 10:132439385-132439407 TGCCACCTACATCCCCGGGATGG + Intergenic
1077442702 11:2576058-2576080 CTCCTCCTGGATCACCTGGGTGG - Intronic
1080001746 11:27358622-27358644 TTCCTTCTGCAAGACTGGGAAGG - Intronic
1084367039 11:68708472-68708494 TTCCTCATGCATCTCCTGGGAGG - Exonic
1085128275 11:74016855-74016877 TTCCTCCTGCCTCCCCAGGAAGG - Intronic
1088932812 11:114369217-114369239 TTCTGCCTGCATCACAGGTAAGG - Intergenic
1089791581 11:120948887-120948909 TTCCTCCTGTATAACATGGAAGG - Intronic
1096239129 12:49950264-49950286 TTATTCCTGCTTCACAGGGATGG - Intergenic
1100888486 12:99099000-99099022 TTCCTGCTGCATCTCCAGGATGG + Intronic
1101054848 12:100901833-100901855 TTCCCCATGCATCACCTGGGTGG - Exonic
1102011548 12:109622229-109622251 TGCCTCCTGCAGCTCGGGGAGGG + Intergenic
1102061526 12:109935756-109935778 TTCCTCCTGCTACACAGAGAAGG + Intronic
1102612233 12:114122388-114122410 TTCGTCCTGCATGATTGGGAGGG + Intergenic
1104013162 12:124946514-124946536 GTCCTCCTCAATCACCGGGCGGG + Intergenic
1104714100 12:131005271-131005293 TTCCTCCAGCATCAGCAGGGAGG + Intronic
1105293735 13:19071119-19071141 TTCCTGCTACATCACAGGGAGGG - Intergenic
1106409506 13:29501429-29501451 GTCCTCCTGCAGCACTGGGAGGG + Intronic
1107836707 13:44417598-44417620 TGCCTCCAGCATCACCCGAATGG + Intergenic
1109359726 13:61280460-61280482 TTGCTCCTGCATCAATGTGAAGG - Intergenic
1113150541 13:107258618-107258640 TGGCTTCTGCATCACCGTGATGG - Intronic
1117377311 14:55128587-55128609 TTCCTAATACATCACCGTGAGGG + Intronic
1118902428 14:69997854-69997876 TTCAGCCTGCATCCCCGGGGAGG + Intronic
1120358597 14:83465331-83465353 TTTCTCCTCCATCACAGTGAAGG + Intergenic
1121709248 14:96025170-96025192 TTGCTCCTGCATAACAGGGAAGG + Intergenic
1122183140 14:99970506-99970528 TTCCTCATGCATTACCAGTATGG - Intergenic
1122828171 14:104382421-104382443 TACCTCCGGCATCACAGGGCCGG + Intergenic
1124871231 15:33545018-33545040 ATCCTGCTGCATCAAGGGGAAGG + Intronic
1128604749 15:69028273-69028295 TGCCTCCTGCAGCTCCTGGAGGG - Exonic
1136373334 16:29849448-29849470 TTCCTCCTGCAGCAACGGTCAGG - Intergenic
1139249409 16:65480538-65480560 TACCTCCTGTATCAGCAGGAGGG + Intergenic
1139998317 16:71001655-71001677 TTCCTCTTGAGTCACAGGGAAGG + Intronic
1140628424 16:76822591-76822613 TTCCATCTGAATCACCTGGAAGG + Intergenic
1141252236 16:82369274-82369296 CTCCTCCTCCATCACGTGGAAGG + Intergenic
1141720311 16:85751874-85751896 TTCCTCCTGCCCCACTGGGCAGG - Intergenic
1142145543 16:88491453-88491475 TGCGTCCTGCATCCCCGGGCTGG - Intronic
1143408715 17:6695866-6695888 CTCCTCCTGCAGCACCTTGAGGG + Exonic
1146218993 17:31002191-31002213 TTCCTTATGCATCAACAGGAAGG - Intergenic
1146226857 17:31074516-31074538 TTTCTCCTGGATCACAGGGCTGG + Intergenic
1146639747 17:34531218-34531240 TCCTTCCTGCATCTCTGGGATGG - Intergenic
1146647529 17:34584991-34585013 TTCCTCCTGCATCTCCAAAAGGG - Intronic
1151455373 17:74222610-74222632 CTCCTGCTGCATCACCTGGACGG + Exonic
1151819151 17:76488005-76488027 TTCCACCTGCCTCACTGGTAAGG + Intronic
1151917336 17:77127968-77127990 TCCCTCCTGCAGCTCTGGGAAGG - Intronic
1153900846 18:9615197-9615219 TTCCTCGTGCAGCACGGTGAAGG + Intronic
1156269392 18:35517090-35517112 TTCCTCCTGCAACTCCAGCATGG + Intergenic
1157814657 18:50721977-50721999 TTCCTCCCGGATTACAGGGATGG - Exonic
1158171596 18:54606326-54606348 TTGATCTTGCATCACCGGGCAGG + Intergenic
1160042864 18:75361149-75361171 TTCCCTCTGCACCACCTGGACGG - Intergenic
1160798368 19:955939-955961 CTCCTCCTGCAGCCCCTGGAGGG - Intronic
1160943739 19:1631735-1631757 CTCCTCCTGCTTCCCGGGGAGGG - Intronic
1161415421 19:4144088-4144110 TTCCTCCTCCACCAACGGGAAGG + Intergenic
1162918254 19:13885632-13885654 TTCCTCCTGAGTCCCTGGGAAGG - Intronic
1163027159 19:14518857-14518879 TTCGTCCGGCGTCACCGGGCGGG - Intronic
1167123284 19:47531850-47531872 TCTCTCCTGCATCTCAGGGAGGG + Intronic
925839644 2:7979580-7979602 TTCCTCCTGCTCCAGCGGGTAGG - Intergenic
925855176 2:8122647-8122669 TTCCAGCTGCGTCACAGGGAGGG - Intergenic
926129438 2:10292451-10292473 TTCCTCCTCCATCCCTGGCATGG + Intergenic
927187091 2:20489716-20489738 ATGCACCTGCATCACCTGGAGGG + Intergenic
930857570 2:56035441-56035463 TTCCTCATGCTTCATGGGGAAGG + Intergenic
934683607 2:96304716-96304738 TTCCTCCTGCATCTGCGGTTTGG + Exonic
937349347 2:121150582-121150604 TGGCTCCTGCTTCACAGGGATGG - Intergenic
946180880 2:217948318-217948340 TTCCCCCTCCATCACAGAGAAGG + Intronic
946424150 2:219583653-219583675 TTCCTCCTTTATCACAGGAAAGG + Intergenic
948776080 2:240289779-240289801 TTCCTCCTGGAACCCCAGGAGGG - Intergenic
949040912 2:241849640-241849662 TTCCTCCAACATCACGGGGCTGG - Intergenic
1171188359 20:23139846-23139868 TTGCTCCTGCTTCACCCGGCAGG - Intergenic
1171749200 20:29031500-29031522 TTCCTCCTGCATCTCGGAGCAGG - Intergenic
1172165284 20:32895047-32895069 TCCCTCCTCCATCCCTGGGAGGG + Intronic
1175206813 20:57317505-57317527 TTCTGCCTGGATCACTGGGATGG + Intergenic
1175547814 20:59790337-59790359 TTCTCCCTGTATCACCGGGCTGG - Intronic
1176315980 21:5244188-5244210 TTCCTCCTGCATCTCGGAGCAGG + Intergenic
1178914372 21:36698654-36698676 TTGGACCTGCAACACCGGGAGGG + Intergenic
1178923286 21:36754325-36754347 TTCCTCCAGGTTCACCAGGAGGG - Exonic
1180393781 22:12310129-12310151 TTCCTCCTGCATCTCGGAGCAGG + Intergenic
1180405966 22:12554619-12554641 TTCCTCCTGCATCTCGGAGCAGG - Intergenic
1183254503 22:36753666-36753688 TTCCTTCTGCATCTCCAGGATGG + Intergenic
1184198906 22:42951554-42951576 TTGCTCCTGCATCCCCCGGTTGG + Intronic
1184598791 22:45530250-45530272 TTTCTCCTGCATCTCGGGGGTGG + Intronic
953927520 3:46989937-46989959 TACCTCCTGTGTCTCCGGGATGG - Intronic
955858073 3:63296049-63296071 TTCCTCCTGCATTACCTGCCTGG - Intronic
959335265 3:105056871-105056893 TTCCTCCTGCATCAGCCAGGTGG + Intergenic
961203935 3:125066141-125066163 TTCCTCAGGCCTCACCCGGATGG + Intergenic
962065252 3:131972802-131972824 TTCCTCCTCCATAAATGGGAAGG + Intronic
963258964 3:143175301-143175323 TTCCTCCTGCCTCACCTTGAGGG + Intergenic
969652469 4:8475888-8475910 TTCTTCATGCATCACCCTGATGG + Exonic
974927551 4:68319139-68319161 TTCCTTCTGCTTCACAGGGAAGG + Intronic
975220085 4:71804741-71804763 TTCGTCTTGCATCACTGGGCAGG + Intergenic
975220655 4:71809252-71809274 TTCGTCTTGCATCACTGGGCAGG + Intergenic
980906331 4:138951809-138951831 ATCCTCCTGCCTCATGGGGAAGG - Intergenic
981341589 4:143627955-143627977 TTCCTCCTGCTTAATCTGGAGGG + Intronic
981865820 4:149417689-149417711 TTTCTCCTGCATAACAGAGAGGG - Intergenic
981989624 4:150902396-150902418 ATTCTCCTGCCTCACTGGGATGG - Intronic
984698956 4:182806465-182806487 CCCCTCCTGCATCCCCGGGCGGG + Intergenic
985123774 4:186669965-186669987 TTCCACCTGTGTCAGCGGGAGGG - Intronic
985431082 4:189881110-189881132 TTCCTCCTGCATCTCGGAGCAGG - Intergenic
986055517 5:4132932-4132954 CTCCTGTGGCATCACCGGGATGG - Intergenic
986237500 5:5925844-5925866 TTGTTCCTGCATGACCGTGAGGG + Intergenic
990911034 5:60852516-60852538 TTTCTCCTGCATCACCCTGAAGG + Intergenic
991609497 5:68435810-68435832 TTCCTCCGGCAGCACAGGGCAGG + Intergenic
1002060091 5:176620838-176620860 TTCCTCCTGCATCACCGGGATGG + Exonic
1006182455 6:32162597-32162619 TTGCTCCTCCATCTCCAGGACGG - Exonic
1009774619 6:68190305-68190327 TTACACCAGCATCACCTGGAAGG - Intergenic
1011860636 6:91751555-91751577 TTCCTCTTGCCTCACCTGGGAGG - Intergenic
1015961473 6:138653926-138653948 TTGCTACTGCATCACTGGGTTGG - Intronic
1019773345 7:2897315-2897337 TTCCTCCTGCAGCACTGGGCTGG + Intergenic
1019808914 7:3149853-3149875 TTCCTCCTGCATCACCTTTGTGG + Intronic
1020188137 7:5974278-5974300 TTCTTCCTGCAGCACCCTGAGGG + Intronic
1020294781 7:6750491-6750513 TTCTTCCTGCAGCACCCTGAGGG - Intergenic
1022020864 7:26398515-26398537 TTCCTCCTCCAGCACCGGGCCGG + Intergenic
1024241268 7:47438460-47438482 TTCCTCCTTCATCACTGAGGCGG - Intronic
1026302120 7:69107116-69107138 TTCCTCCTGCATCTCCCAGGAGG - Intergenic
1028543392 7:91970671-91970693 TTCCTCCTGTATGACCTGTATGG + Intronic
1034982679 7:155488835-155488857 TTCCTCCTGCAACCCTGAGAGGG + Intronic
1035647059 8:1232509-1232531 TTCCTCTTGCATCACTGTGCTGG + Intergenic
1038577486 8:28717435-28717457 CTCCCCCAGCACCACCGGGACGG - Exonic
1039413482 8:37374941-37374963 TTCCACCTGCAAATCCGGGAGGG - Intergenic
1039965150 8:42278623-42278645 GTCTGCCTGCATCACTGGGACGG - Intronic
1040602439 8:48897747-48897769 TCCCTCCAGAATCACTGGGATGG + Intergenic
1042014495 8:64292995-64293017 TTCCTCCTCTATCTCAGGGAAGG + Intergenic
1042496040 8:69455664-69455686 TTCCTCCCTCATCACCAGCAGGG + Intergenic
1049158926 8:141084907-141084929 GTCCTCCTGCGGCCCCGGGAGGG + Intergenic
1049547313 8:143239154-143239176 TCCCTCCTGCATGACGGGGTAGG - Intergenic
1049554470 8:143275176-143275198 CTCCTCCTGCATCCCCTAGATGG + Intronic
1051242023 9:15067748-15067770 TTTCCCCTCCATTACCGGGATGG - Intergenic
1053720290 9:40939302-40939324 TTCCTCCTGCATCTCAGAGCAGG - Intergenic
1055138883 9:72852616-72852638 TTCCGCCTGCAGCAATGGGAAGG - Intergenic
1056278389 9:85015691-85015713 TTCCTGCTGCAGCTCAGGGATGG - Intronic
1056874169 9:90311976-90311998 TTCCTCCTGCCTTCCCCGGATGG - Intergenic
1059922867 9:119177774-119177796 TTCCTCCTGCCTGACAGGGCTGG - Intronic
1061715382 9:132515361-132515383 GTCCTCCTGCAGCCCTGGGAGGG - Intronic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1203454839 Un_GL000219v1:156529-156551 TTCCTCCTGCATCTCGGAGCAGG + Intergenic
1185463159 X:341529-341551 CTCCTCCTGCCTCTCCGGGGAGG + Intronic
1188085106 X:25894241-25894263 TTGATCTTGCATCACCGGGCAGG - Intergenic
1188316933 X:28686797-28686819 TGCCTTCTGCATCACCTGAATGG + Intronic
1192220262 X:69192988-69193010 TTCCCCCTGCAACACCTTGAGGG + Intergenic
1197291461 X:124663719-124663741 TTCTTACTGCATCACAGGAAAGG + Intronic
1199390174 X:147269662-147269684 TTGATCTTGCATCACCGGGCAGG - Intergenic