ID: 1002060837

View in Genome Browser
Species Human (GRCh38)
Location 5:176625034-176625056
Sequence GACCCTGCCTCCATGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002060837_1002060842 -8 Left 1002060837 5:176625034-176625056 CCCATCCCCATGGAGGCAGGGTC 0: 1
1: 0
2: 0
3: 16
4: 214
Right 1002060842 5:176625049-176625071 GCAGGGTCTGCACGCGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002060837 Original CRISPR GACCCTGCCTCCATGGGGAT GGG (reversed) Intronic
900298393 1:1964388-1964410 GTCCAGCCCTCCATGGGGATGGG + Intronic
902467692 1:16628390-16628412 GACAGTGCCCCCATGGGGTTAGG - Intergenic
902639558 1:17758143-17758165 GAGGCTGCCTCCATTGAGATGGG + Intronic
902709098 1:18226564-18226586 GACCCAGCCTCCAGGGTGAGGGG - Intronic
903017222 1:20368985-20369007 GACCCTGCCTGCTTGGAGCTTGG + Intergenic
903193045 1:21667504-21667526 AACCCTCCCTCCATGGGAAGGGG + Intronic
903393385 1:22980943-22980965 CCCTCTGTCTCCATGGGGATTGG + Intergenic
904389699 1:30174139-30174161 GATCCAGCCTCCATTGGGAGTGG - Intergenic
904602798 1:31683167-31683189 GCCTCTGCCTCCATGGGTATTGG - Intronic
907157047 1:52344129-52344151 GACCCTTCCTCTATGGTGCTAGG + Intronic
908795504 1:67827209-67827231 GACCTTGCCTGCAAGGGGAGTGG + Intronic
909139860 1:71849742-71849764 GATCTTGCCTCCATGTTGATGGG - Intronic
910601203 1:89034324-89034346 GAGCAAGCCTCCATGGGCATAGG + Intergenic
915532347 1:156509962-156509984 GACCCTGGCACCATCGGTATGGG + Intergenic
915646233 1:157274683-157274705 GAGCCTTCCTCCAGGGGGACTGG - Intergenic
915785181 1:158603046-158603068 GACCCAGCCTCAATGTGGGTGGG - Intergenic
918104971 1:181409001-181409023 GAACCTGCTTCCATGGGCGTAGG + Intergenic
920446297 1:206021235-206021257 GACCCTGCCGCTGTGGGGCTGGG - Intronic
921951226 1:220932187-220932209 GTCCCTGTGTCCATGGGGCTGGG + Intergenic
922122110 1:222681748-222681770 GCCACTGCCACCATGGGGAGGGG + Intronic
922554027 1:226519471-226519493 GACTCTGCCTGCCTGGGGAGGGG + Intergenic
924037598 1:239953157-239953179 GACCCAGCCTCCCTGGTGGTGGG + Intergenic
1062815920 10:499948-499970 GACCCTGCCACAATGGGACTGGG + Intronic
1064883203 10:20080649-20080671 GACCCACCCTCAATGGGGTTGGG - Intronic
1065935531 10:30517502-30517524 GACCCTGCCACCATGGTGCTTGG + Intergenic
1068620595 10:59177036-59177058 GACCCTGCCGCCCTGGCGAGCGG - Intronic
1068985882 10:63107208-63107230 GACGCTGCCTACCTGGAGATTGG - Intergenic
1071284028 10:84127758-84127780 GAACATGCCTCCCTGAGGATTGG - Intergenic
1072244977 10:93535322-93535344 GAGCCAGGCTCCATGGGCATGGG - Intergenic
1073181669 10:101587443-101587465 GACCCTACCTCCATAGGCAAAGG - Intronic
1073544053 10:104334332-104334354 GGCCCAGCCTCCATGCTGATTGG + Intronic
1074184938 10:111092986-111093008 GACCCACCCTCAATGTGGATGGG - Intergenic
1076182510 10:128421535-128421557 GAAGCTGTCTCCATGAGGATGGG - Intergenic
1076933923 10:133555165-133555187 GACCATGTGGCCATGGGGATGGG - Intronic
1077444458 11:2583850-2583872 GATTCTGCCTCCATGGGGCGTGG - Intronic
1078489301 11:11754581-11754603 GGCCTTGCCTGAATGGGGATGGG - Intergenic
1080803054 11:35626509-35626531 GACGCTGCCTCCATGAAGCTTGG + Intergenic
1081856033 11:46304599-46304621 GTCCCTGCCTTCATGGGGTTTGG - Intronic
1083420772 11:62551817-62551839 GACACTGCCTCCCTGGGGAGTGG + Intronic
1084147939 11:67274948-67274970 GACCCTGCCTGGATGGGAAGAGG - Intronic
1084350713 11:68597150-68597172 GACTCTGCCTCCAGGGGCTTGGG + Intronic
1086855069 11:91856121-91856143 GACCCTGACTGCACGGGGAATGG + Intergenic
1089069267 11:115686924-115686946 GCCTCTGCCTCCACTGGGATAGG + Intergenic
1091680820 12:2525335-2525357 GAGCCTGCATCCACTGGGATAGG + Intronic
1095792369 12:46181594-46181616 GACCCATCCTCAATGGGGGTGGG + Intergenic
1099448056 12:82775439-82775461 GACCCTGTCTCCAGGGGGGCGGG + Intronic
1100380167 12:94054451-94054473 TCCCCTGGCTCCATGGGGACAGG + Intergenic
1101831105 12:108257274-108257296 CACCCTGCCTCCATGGGCTGGGG - Intergenic
1102146652 12:110659545-110659567 GGCTCTGCCACCTTGGGGATGGG + Intronic
1102950274 12:117026484-117026506 GTCCCTGCCTCCCTGGGGTTGGG - Intronic
1103735156 12:123056498-123056520 GACACTGCCTTCATGGGCCTGGG + Intronic
1104133439 12:125916327-125916349 GACCCTCCCTCAATGTGGGTGGG + Intergenic
1104347268 12:128011869-128011891 AACCCTGGCCCCATGGGGAATGG + Intergenic
1104911904 12:132243779-132243801 GGCCCTGCCTGCCTGGGGACTGG + Intronic
1105269649 13:18859964-18859986 GACCCAGCCTACATGGACATGGG + Intergenic
1108615649 13:52129166-52129188 GACCCTGCCTCGAGGTGGACTGG - Intergenic
1108759496 13:53545687-53545709 GAGCCTCCATCCATGGGGGTTGG + Intergenic
1110634682 13:77752861-77752883 GACCCACCCTCCATCTGGATAGG - Intronic
1110728439 13:78852941-78852963 GAGCCTGGGTCCATGGGGGTTGG - Intergenic
1113284224 13:108828852-108828874 TACCCTGCATCCTTGGGGAGGGG + Intronic
1117699771 14:58401122-58401144 GACTGTGGCTCCTTGGGGATGGG + Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1122091045 14:99340824-99340846 GGCCCTGCTTCCTTGGGGACTGG - Intergenic
1122507102 14:102238644-102238666 GAGCCTTCCTCCAGGGGGACTGG + Intronic
1124193180 15:27598039-27598061 GACCAAGCCTCCTTGGGAATGGG + Intergenic
1125735262 15:41920386-41920408 GAATCTGCCTCCCTGGGGAAAGG - Intronic
1125747097 15:42004611-42004633 GTTCCTGCCACCATGGCGATGGG - Intronic
1127145527 15:56019245-56019267 GACCCACCCTCCATGTGGGTGGG + Intergenic
1128302207 15:66573235-66573257 GGCCCTGGCTCCATGGGAAGGGG + Intergenic
1128551564 15:68601057-68601079 GTGCCTCCCTCGATGGGGATGGG + Intronic
1130830593 15:87594696-87594718 TTCCCTGCCTCCAGGAGGATCGG + Intergenic
1132141412 15:99399836-99399858 GACCATGTCTCCATGGGTGTGGG + Intergenic
1132145016 15:99424505-99424527 GCCCCTTCATCCATGGGGATGGG - Intergenic
1132662241 16:1066650-1066672 GACCCTGCCTCCAGGGGCTAGGG - Intergenic
1132681090 16:1142029-1142051 GGCCGTGCCTCCCTGGGGCTGGG + Intergenic
1132853004 16:2033229-2033251 GGCCCTGGCTCCCCGGGGATGGG - Intronic
1133562760 16:6965115-6965137 GACTCTGCCTCCATGGTTCTCGG + Intronic
1134820908 16:17246735-17246757 GCCCCTGCCTGCACGGGGCTAGG - Intronic
1136146345 16:28318810-28318832 GACCCTGCCTGCATGGCCTTGGG + Intronic
1137419522 16:48319787-48319809 GGCACTAACTCCATGGGGATGGG + Intronic
1137677471 16:50310904-50310926 GAACAGGCCACCATGGGGATGGG - Intronic
1138509864 16:57502267-57502289 GTCCCTGACTCCTTGGTGATTGG + Intergenic
1139968830 16:70761237-70761259 GAGCCTCACTCCATGGGGACTGG + Intronic
1140478127 16:75249126-75249148 GATCCTGCCTGCAGGGGTATAGG - Intronic
1140738721 16:77922783-77922805 AATCCTGGCTCCATGGGGAGGGG - Intronic
1140859524 16:79006759-79006781 GACCCTGAGTCCATGAAGATGGG - Intronic
1143477424 17:7210929-7210951 CACCCTCCCTCCATGGGGGTGGG - Intronic
1145103450 17:20095799-20095821 CACCCTGAGTCCATGGGGACAGG + Intronic
1145263202 17:21366725-21366747 GACCCTGTCACCATGGGCAGTGG - Intergenic
1146619868 17:34389018-34389040 GTCCCTGCCACCACGGGGAAAGG - Intergenic
1147652349 17:42069716-42069738 GACCCTGCCTCGCTGGGCTTTGG + Intergenic
1147705215 17:42421483-42421505 GATCCCGCCTCCCTGGGGTTAGG + Intronic
1147747128 17:42701594-42701616 GGCCTTGCCTCTATGGGGAATGG + Exonic
1148676854 17:49450821-49450843 GAGCCTGCCTTCCTGGGGGTGGG - Intronic
1148790575 17:50170433-50170455 GACCCAGACACCATGGGAATGGG + Intronic
1154418398 18:14200019-14200041 GACCCAGCCTACATGGACATGGG - Intergenic
1155622472 18:27795198-27795220 GACCCACCCACCATGGGGAAGGG + Intergenic
1156518905 18:37704986-37705008 GGCCCTGCCACCACAGGGATGGG + Intergenic
1158416427 18:57253117-57253139 GGCACTGTCTCCAGGGGGATGGG - Intergenic
1158498073 18:57974529-57974551 GTCCATGACTCCATGGGGAGAGG - Intergenic
1159005267 18:63005072-63005094 GACCCTGGTTCCATTGGCATGGG + Intergenic
1159870569 18:73756515-73756537 GGCCCTGCTTCCATGGAGCTTGG + Intergenic
1160210482 18:76874109-76874131 GGCTCTGCCTGCATGGGGACAGG - Intronic
1161241945 19:3227687-3227709 GAGCCCACCTCCATGGCGATGGG - Intronic
1161983623 19:7642869-7642891 GGCCCTGCGCCCATGGGGAGGGG - Intronic
1162060087 19:8089761-8089783 GACCCTGCCAGCCTGGGGCTTGG - Intronic
1165314965 19:35049233-35049255 GACCCTGCCGCAATGAGGACAGG + Intronic
1165436798 19:35799949-35799971 GACGCCGCCTCCTTGGGGAAGGG - Intergenic
1167103568 19:47418489-47418511 GAGCCTGTCTCCCTGGGGATGGG - Intronic
1167995101 19:53395566-53395588 GACGCGGCCTCCTTGGGGCTGGG - Intronic
926819484 2:16837004-16837026 GCTCCTGCCTCCATCAGGATTGG + Intergenic
927645072 2:24872465-24872487 GCCCCTGGCTCCGTGGGGCTTGG - Intronic
928595703 2:32856987-32857009 CCCCCTGCCACCCTGGGGATAGG - Intergenic
928710288 2:33997485-33997507 GAGCCTGTATCCATGGGGATTGG + Intergenic
931760457 2:65412271-65412293 GAATCTGCCTCCATGAGTATGGG - Intronic
935187335 2:100745979-100746001 GACCCTCCCTCAATGTGGGTTGG - Intergenic
936083461 2:109450996-109451018 GGGCCTGCCTCCAGGGTGATGGG - Intronic
939051947 2:137317916-137317938 GACCCTGTCTCTATGGGGGAGGG + Intronic
940868996 2:158844266-158844288 GCCCCTGCCTCCATGAGTGTAGG + Intronic
941400246 2:165021531-165021553 GACCCACCCTCAATGTGGATGGG - Intergenic
941715185 2:168756150-168756172 CATCCTGCCTCTATGAGGATGGG + Intronic
945758918 2:213886301-213886323 TGTCCTGCCTCCATGGGGAACGG + Intronic
946633343 2:221696569-221696591 GTCCATGACTCCATGGGGAGAGG - Intergenic
947642862 2:231716629-231716651 GCCCATGCCTCCATGGGCCTGGG - Intergenic
947774975 2:232701357-232701379 GACCCTGTCTCCTGGGGGTTTGG + Intronic
948479409 2:238240549-238240571 GACCCTGCCTCCCCGGGGCTTGG - Intronic
948502337 2:238404874-238404896 GACCCTGACTCCTGGGGGAGGGG - Intergenic
948907588 2:240987105-240987127 CACCCTGGCTCCATGGCGCTGGG - Intronic
949027888 2:241774826-241774848 GAACCCGCCTCCATCGGCATTGG - Intergenic
1171214114 20:23339964-23339986 GGCCCTGTCTTCATGGGGATGGG - Intergenic
1173153466 20:40587496-40587518 GACCCTCAATCCATGGGGCTTGG - Intergenic
1174103087 20:48142138-48142160 GTCCCTTCCTCCTAGGGGATGGG + Intergenic
1174506588 20:51021492-51021514 GACTCTGCCATCATGGGTATGGG + Intronic
1174619423 20:51862857-51862879 GACCCTTGGACCATGGGGATGGG - Intergenic
1174944870 20:54974044-54974066 GACCCACCCTCAATGTGGATGGG - Intergenic
1175357705 20:58381960-58381982 TACCCTGACTCCATGGGGGAGGG + Intergenic
1176030475 20:63008952-63008974 GACGCTGACGCCATGGGGCTGGG + Intergenic
1176834797 21:13783293-13783315 GACCCTCTCTCCATGGTGCTAGG + Intergenic
1176854904 21:13959271-13959293 GACCCAGCCTACATGGACATGGG + Intergenic
1179041954 21:37811183-37811205 CACCCCAACTCCATGGGGATAGG + Intronic
1184172077 22:42765730-42765752 GCCCCTCCCTCCAGGGGGAAGGG - Intergenic
1185250655 22:49799925-49799947 GACCCTACCTCAAAGGGGAGAGG + Intronic
951555532 3:23917247-23917269 GACCCTGCGTCCTCGGAGATAGG + Intronic
951689900 3:25384501-25384523 GGCCCTGCATCCCTGGGGACAGG + Intronic
952006442 3:28847263-28847285 CGCCCTTCCTCTATGGGGATAGG - Intergenic
953407544 3:42666908-42666930 GCCCCTGCCCCACTGGGGATAGG + Intergenic
953669488 3:44950567-44950589 GGCCCTGCCTGAATGGAGATGGG - Intronic
954754261 3:52830718-52830740 GAACCTGCCCCCATGTGGGTGGG - Exonic
954863287 3:53708044-53708066 GACTCTGCCACCCTGGGGCTTGG + Intronic
960939324 3:122923144-122923166 TTCCCTTTCTCCATGGGGATGGG + Intronic
961475367 3:127142589-127142611 GGGCCTGGCTCCAGGGGGATAGG + Intergenic
962750678 3:138432933-138432955 GATCCTGTCTCCAAGGGGTTTGG + Intergenic
963660930 3:148128481-148128503 GAGCCTCCCTCAATGTGGATGGG + Intergenic
963661726 3:148134924-148134946 GACCCACCCTCAATGTGGATGGG + Intergenic
965551121 3:169966468-169966490 GACTCTGACTCTAAGGGGATGGG + Intergenic
968045173 3:195619911-195619933 GACCCAGCCTCTATGGAGACCGG - Intergenic
968061025 3:195726254-195726276 GACCCAGCCTCTATGGAGACCGG - Exonic
969497255 4:7533263-7533285 GCCCCTGCTTCCATAGGGTTTGG - Intronic
969592124 4:8127886-8127908 GACCCTTCCTCCATGTGTAGGGG + Intronic
970650887 4:18176532-18176554 GAACCAGCCTCCATGGTGCTGGG - Intergenic
970787908 4:19821974-19821996 GACCCACCCTCAATGTGGATGGG + Intergenic
970925923 4:21452293-21452315 GACCCTGCCTTCATGGAGGTGGG + Intronic
973532127 4:51844250-51844272 GACCCTGCCTCGACAGGGAGAGG - Intronic
973648143 4:52970393-52970415 GAGCCAGGCTCCATGGGCATAGG - Intronic
982222833 4:153139681-153139703 GACCCACCCTCAATGTGGATGGG + Intergenic
985246165 4:187981786-187981808 GAGACTGCCTGCATGAGGATTGG + Intergenic
985731888 5:1553983-1554005 GACCCTGGCTCTGTGGGGCTTGG + Intergenic
985928371 5:3035228-3035250 GACCCCACCTCCATAGAGATGGG - Intergenic
986191711 5:5502652-5502674 GACCCTCCCTCCATGTAGGTGGG + Intergenic
986760750 5:10877475-10877497 GACCCTCCCTCAATGTGGGTAGG - Intergenic
987182058 5:15378311-15378333 GACCCGCCCTCAATGTGGATGGG - Intergenic
988641987 5:33050147-33050169 CACCCTGCCTCTATGGGAAGTGG + Intergenic
990230304 5:53705961-53705983 GACCAAGGCTCCATGGGCATGGG + Intergenic
990332111 5:54738455-54738477 GCCCCTCTCTCCATGGGGCTAGG + Intergenic
990833836 5:59991966-59991988 GACCCACCCTCCATGTGGGTAGG + Intronic
993591492 5:89800773-89800795 GAGCAAGCCTCCATGGGCATGGG - Intergenic
997834717 5:137182887-137182909 TACCAGGCCTCCATGGAGATTGG - Intronic
999835007 5:155360295-155360317 GGCCTTGCCTCCATGTTGATGGG + Intergenic
1000833706 5:166131806-166131828 GAGCCTCCCTCCAAGGGGATTGG - Intergenic
1002060837 5:176625034-176625056 GACCCTGCCTCCATGGGGATGGG - Intronic
1006838232 6:37011966-37011988 GGCCATGCCTCCCTGGGGCTCGG + Intronic
1011104304 6:83761952-83761974 GCCCCAGCTTCCCTGGGGATTGG + Intergenic
1011288607 6:85752001-85752023 GAGCAAGCCTCCATGGGCATGGG - Intergenic
1014390570 6:120857532-120857554 GAGCCTGTGTCGATGGGGATGGG - Intergenic
1016181408 6:141152403-141152425 GACCCACCCTCAATGTGGATGGG - Intergenic
1017378632 6:153800740-153800762 CACCCTGACTCCATGGGGAGAGG - Intergenic
1018861596 6:167714084-167714106 TTCTCTGCTTCCATGGGGATGGG + Intergenic
1018940964 6:168308649-168308671 CACCCTGCCTCTGTGGAGATGGG + Exonic
1019183368 6:170207011-170207033 TACCCAGCCTCCCTGGGGTTGGG + Intergenic
1019842598 7:3463141-3463163 TTCCCTGACTCCATGGAGATGGG + Intronic
1023159285 7:37282016-37282038 GATTCAGCCTCCATGTGGATGGG + Intronic
1023608851 7:41954559-41954581 GACCCTGGCTCCATAAGGAGAGG + Intergenic
1024035693 7:45505978-45506000 GCCCATGCCTCCATGTGGTTGGG - Intergenic
1026530371 7:71192231-71192253 GACCCACCCTCAATGGGGGTGGG - Intronic
1027281960 7:76615372-76615394 GGCCCTGCTTCAATGGGGCTGGG - Intronic
1028936949 7:96475606-96475628 AAGCCTGCCTTCATGTGGATTGG + Intergenic
1028982887 7:96986268-96986290 GACCCTGCCTCCATAAGAGTAGG - Intergenic
1029053528 7:97715559-97715581 GACCCTGCATCCATGAGTATGGG - Intergenic
1029514239 7:101016000-101016022 GACCCAGCCTGGGTGGGGATAGG + Intronic
1031505072 7:122572373-122572395 TCCTCTGCTTCCATGGGGATGGG - Intronic
1031700574 7:124919890-124919912 GTCCCTGCCCCCATGGGACTTGG + Intronic
1032427145 7:131831272-131831294 ATCTCTGCCTCCCTGGGGATTGG - Intergenic
1032679490 7:134167425-134167447 TGCCCTGGCTCCATGGTGATGGG + Intronic
1033220746 7:139524910-139524932 GACACTGCCTCCCTAAGGATGGG - Intronic
1036032291 8:4987734-4987756 GACCCTCCCTCAATGTGGGTGGG + Intronic
1047636512 8:126768833-126768855 ATCCCTGTCTCCATGGTGATAGG - Intergenic
1048523232 8:135176914-135176936 GACCCTGACTACATAGGGCTTGG + Intergenic
1049367202 8:142246224-142246246 AGCCCTGCCTTCATGGGGGTAGG - Intronic
1049777201 8:144412235-144412257 GACCCTGCCTGCCTGAGGAGTGG - Intronic
1049803821 8:144530092-144530114 GACGCTGCCTCCTTGGGGCCGGG - Exonic
1049849045 8:144821018-144821040 GGTCCAGCCTGCATGGGGATAGG - Intergenic
1052560413 9:30077491-30077513 GACCCACCCTCAATGTGGATGGG - Intergenic
1053209778 9:36218083-36218105 GACCCTGCTTCCCTAGGGACAGG - Intronic
1055085058 9:72305341-72305363 AACCCTGGCTCCAGGAGGATGGG + Intergenic
1058529203 9:105889235-105889257 CTCCCAGCCTCCATGGGGATGGG - Intergenic
1059770031 9:117415447-117415469 GGCCCCGCCTTCTTGGGGATAGG + Intergenic
1060201609 9:121654732-121654754 GACCAAGCCCCCATGTGGATGGG - Intronic
1062081432 9:134626051-134626073 GTCCCTGCCTGCATGGGGTCTGG - Intergenic
1186169075 X:6858231-6858253 TACCCTGATTCCATGGGGAGAGG + Intergenic
1186534309 X:10330628-10330650 GAGCTTCCCTCCATGGGGCTTGG - Intergenic
1193066776 X:77268508-77268530 GAGCATGACTCCATGGGCATGGG - Intergenic
1193456122 X:81733739-81733761 GACCCACCCTCAATGTGGATGGG + Intergenic
1193699255 X:84742626-84742648 GAACCTTCCTCCAGGGGGACAGG + Intergenic
1197122984 X:122913908-122913930 GAGCCTGAGTTCATGGGGATTGG + Intergenic
1198316971 X:135477731-135477753 AATCCTGCCACCATGTGGATGGG + Intergenic
1198940758 X:141952837-141952859 GAGCCTGCGTCCATGGGTGTTGG + Intergenic
1199483462 X:148323766-148323788 GACCCAGCCACCATGCGGAGTGG - Intergenic
1199949758 X:152698643-152698665 GATTCTGCCTGGATGGGGATCGG - Intergenic
1199959916 X:152769818-152769840 GATTCTGCCTGGATGGGGATCGG + Intergenic
1200928240 Y:8673775-8673797 GAATCTGGCCCCATGGGGATTGG - Intergenic
1201751005 Y:17432134-17432156 GACCCACCCTCAATGTGGATGGG + Intergenic