ID: 1002062070

View in Genome Browser
Species Human (GRCh38)
Location 5:176630946-176630968
Sequence GGTCTCGGGAAGCTTACCAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 39}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002062059_1002062070 30 Left 1002062059 5:176630893-176630915 CCAGTGGTGCAGGTTTAAGGCTG 0: 1
1: 0
2: 1
3: 12
4: 122
Right 1002062070 5:176630946-176630968 GGTCTCGGGAAGCTTACCATGGG 0: 1
1: 0
2: 0
3: 7
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002062070 Original CRISPR GGTCTCGGGAAGCTTACCAT GGG Exonic
902208812 1:14890085-14890107 TGATTCGGGAAGCTTACCACAGG + Intronic
905004892 1:34701515-34701537 GGTCTCTGGAAGCCTGCCACAGG + Intergenic
907241309 1:53082531-53082553 GGGCTGGGGAAGCTTGCCATGGG + Intronic
920194006 1:204213983-204214005 GGTCACGGGAAGCTGACCCTTGG + Exonic
923698346 1:236276996-236277018 GGCCTCAGGAAACTTACAATCGG - Intronic
1075090183 10:119439849-119439871 GGGCTGGGGAAGCTGACCACGGG + Intronic
1075119960 10:119657572-119657594 TGTCCCGGGAAGCCTTCCATTGG + Intronic
1076312786 10:129520589-129520611 GGGCTCTGAAAGCATACCATAGG - Intronic
1078143986 11:8710702-8710724 GGCCTCAGGAAGCATAACATAGG + Intronic
1079146688 11:17858487-17858509 GATCTCTGGAAGTTTACCAATGG + Intronic
1081584835 11:44377078-44377100 GATCTCGGGAAACGTAGCATGGG + Intergenic
1089170653 11:116509165-116509187 AGTCTCAGGAAGCTTCCCAAAGG + Intergenic
1106883445 13:34157021-34157043 TTTCTCGGAATGCTTACCATAGG - Intergenic
1113614992 13:111673979-111674001 GGTGTGGGGAAGATTACCATAGG - Intergenic
1113620461 13:111758893-111758915 GGTGTGGGGAAGATTACCATAGG - Intergenic
1119462916 14:74825489-74825511 GGTCTCTGGAAGATGACAATTGG - Intronic
1133386383 16:5373526-5373548 GGCCTCAGGAAACTTACAATCGG - Intergenic
1134070971 16:11259492-11259514 TGTGTCGGGAAGGTTCCCATGGG + Intronic
1144764340 17:17724679-17724701 GCTCTCGGGAAGTTTCCCATCGG - Intronic
1152195900 17:78918257-78918279 GGGCTCCGGAAGCTTTCCCTGGG + Intronic
1163967869 19:20764893-20764915 GGTGTAGGCAAGCTTGCCATTGG - Intronic
1166347197 19:42173998-42174020 GGTCCAGGGAAGCTTTTCATGGG + Intronic
927147799 2:20178449-20178471 GGTGTCGGGCAGCTTGCCCTGGG - Intergenic
929444685 2:41992615-41992637 GGTCTCTGGAAGCTTAGCCTGGG - Intergenic
932685987 2:73870685-73870707 GGGATAGGGAAGCTAACCATAGG - Intronic
945463386 2:210138552-210138574 TGTCTAAGGAAGCTTAACATTGG + Intronic
1169586858 20:7095545-7095567 GGTTTGGGGAAGCTTGGCATTGG - Intergenic
1184287226 22:43478497-43478519 GGTCAGGGGAGGCTTCCCATGGG + Intronic
1184430348 22:44438622-44438644 GGTCCCGGGAAGCTTAGCTGTGG - Intergenic
957877804 3:86171846-86171868 GGTCTTGGAATGATTACCATAGG - Intergenic
967906882 3:194508867-194508889 TGGCTCGGAAAGCTTACCTTTGG - Intergenic
970757989 4:19449956-19449978 GGTCTCAGGAAACTTATAATAGG + Intergenic
976116684 4:81735593-81735615 GGCCTCAGGAAGCTTACAATCGG + Intronic
992275005 5:75106272-75106294 GGTCTCAGGAACCCCACCATGGG + Intronic
992957635 5:81926606-81926628 GTTGTCAGGATGCTTACCATGGG - Intergenic
1002062070 5:176630946-176630968 GGTCTCGGGAAGCTTACCATGGG + Exonic
1006578869 6:35065116-35065138 GGTCTCGGGAGCCTGACCAAGGG + Intronic
1030031694 7:105375824-105375846 GGTATGGAGAAGCTCACCATAGG + Intronic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1037912824 8:22754173-22754195 GGTCTAGGGCAGCTTCCCAGAGG - Intronic
1040408405 8:47132112-47132134 GCTCTAGGGAAGGTTAACATGGG + Intergenic
1048348031 8:133592707-133592729 GGTCTGGGGAAGATTACATTTGG - Intergenic
1048904703 8:139076374-139076396 GGTTTGGGGAAGCTGCCCATGGG - Intergenic
1052468274 9:28857999-28858021 GGTCTCTGGATTCTTAGCATTGG + Intergenic
1055689049 9:78810008-78810030 GGTCTGGGGAATCATAGCATGGG + Intergenic
1197471832 X:126872918-126872940 GGTCTTGGGAAACTTACATTTGG + Intergenic
1199776236 X:151014290-151014312 GGCCTCAGGAAACTTACAATAGG + Intergenic