ID: 1002064595

View in Genome Browser
Species Human (GRCh38)
Location 5:176645773-176645795
Sequence GAATGAGGGTAGGAGTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002064586_1002064595 14 Left 1002064586 5:176645736-176645758 CCACATGGGTAAGACACAACAGG 0: 1
1: 0
2: 2
3: 12
4: 94
Right 1002064595 5:176645773-176645795 GAATGAGGGTAGGAGTCTGGTGG 0: 1
1: 0
2: 1
3: 24
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002064595 Original CRISPR GAATGAGGGTAGGAGTCTGG TGG Intronic
900661105 1:3784200-3784222 GAATGAGGGCGGGAGTCGGGAGG - Intronic
901929101 1:12585635-12585657 GGGTCAGGGTAGGAGGCTGGAGG - Intronic
902451439 1:16499188-16499210 GAGCGAAGGTAGGAGGCTGGGGG - Intergenic
902823738 1:18958416-18958438 GACTGAGGATAGAATTCTGGGGG + Intergenic
902826576 1:18978778-18978800 GGATGGGGGTAGGAGGCTGAAGG - Intergenic
903285187 1:22272646-22272668 GCAGGAGGGGAGGAGGCTGGAGG + Intergenic
903639383 1:24848256-24848278 GAAGGAGGGAAGGAGGCCGGAGG - Intergenic
903738624 1:25545216-25545238 GAATGAGGGAGGGAGGGTGGTGG + Intronic
904197490 1:28796640-28796662 ACATGAGGGTGGGAGGCTGGGGG + Intergenic
907571609 1:55489000-55489022 GAATGATGGGATGAATCTGGTGG - Intergenic
907710459 1:56875997-56876019 GATTGTGGGTGTGAGTCTGGAGG + Intronic
908043951 1:60148033-60148055 TAATGAGGCTTGGAGGCTGGGGG + Intergenic
910578078 1:88789807-88789829 GAATGAGAATAGGAGTGCGGTGG - Intronic
910686037 1:89917581-89917603 GAAAGAGTATAGGAGTATGGTGG - Intronic
914691556 1:150033367-150033389 GAATGAGTTTGGGAGGCTGGAGG - Intergenic
920098659 1:203502879-203502901 CAAAGAGTGTAGGAGGCTGGTGG - Intronic
920307227 1:205026732-205026754 GAGTGAGGGTTGGGGGCTGGGGG - Intergenic
924946845 1:248852253-248852275 GAATAAGGCTAGTAGGCTGGGGG - Intronic
1064641626 10:17421056-17421078 GTATCAGGGGAGGAGCCTGGTGG - Intronic
1069867929 10:71515100-71515122 GTGTGAGGTTAGAAGTCTGGTGG + Intronic
1070141913 10:73744522-73744544 GAAAGAAGGGAGGAGCCTGGGGG + Intronic
1070320336 10:75350162-75350184 GAATGGGGCTGGGAGCCTGGAGG + Intergenic
1070326688 10:75394395-75394417 GAATGTGGCTAGCAGCCTGGTGG - Intergenic
1070509464 10:77147415-77147437 GAAGGAGGGAGGGAGGCTGGTGG - Intronic
1071427676 10:85575664-85575686 GAATGAGGGCAGGGGCCTGGTGG - Intergenic
1071953177 10:90728308-90728330 GCTTGAGGGGAGGTGTCTGGTGG - Intergenic
1073047126 10:100646128-100646150 GAGGGAGGGGAGGAGGCTGGGGG + Intergenic
1073084685 10:100880545-100880567 GAATCAGTGAAGGAGTCTGTTGG - Intergenic
1073585833 10:104709071-104709093 GAATGAGTGTGAGAGACTGGAGG - Intronic
1074525741 10:114261573-114261595 GAATGGGGTTAAGAGCCTGGAGG + Intronic
1076358766 10:129871594-129871616 GAAGGAGGGAAGGGGTTTGGGGG + Intronic
1077078718 11:713109-713131 GAGAGAGGGTGAGAGTCTGGTGG + Intronic
1077899777 11:6479032-6479054 GGCTGAGAGTAGGAGCCTGGGGG - Intronic
1078395087 11:10973952-10973974 GAGTGAGGGCAGGAGCCAGGAGG + Intergenic
1079904151 11:26224102-26224124 GAAGGAGGGCATGAGTCAGGAGG - Intergenic
1081107585 11:39090109-39090131 GGGTCAGGTTAGGAGTCTGGGGG + Intergenic
1083674573 11:64318318-64318340 GAAGGAGAGTGGGCGTCTGGCGG + Exonic
1084174902 11:67418006-67418028 GCAGAAGGGGAGGAGTCTGGGGG - Intronic
1084365198 11:68693116-68693138 GACTGAGTGCAGGAGGCTGGGGG - Intergenic
1084640256 11:70421590-70421612 GGGGGAGGGTAGGAGGCTGGTGG - Intronic
1084755843 11:71238039-71238061 GACTGAGGGTGGGACTCAGGGGG + Intronic
1085755626 11:79198974-79198996 GAAGAAGGGATGGAGTCTGGAGG + Intronic
1085779185 11:79393067-79393089 AAAAGAGGTTAGGAGCCTGGAGG - Intronic
1085855348 11:80169816-80169838 GGATGATGGTAGAAGACTGGGGG - Intergenic
1088201955 11:107346802-107346824 GAATGGGGGAAGAAGGCTGGAGG - Intronic
1088831732 11:113542454-113542476 GAATGAGAGAAGGAGTCAGGTGG - Intergenic
1089283112 11:117388179-117388201 GCAAGAGGGGAGGAGACTGGTGG - Intronic
1091787846 12:3253725-3253747 TATTGAGGGTGGGAGGCTGGTGG + Intronic
1092996541 12:13956494-13956516 GAATGAGGGTAGGAGAATTCAGG - Intronic
1093205157 12:16239931-16239953 GCAAGAGGGTAGGCCTCTGGTGG - Intronic
1094157975 12:27357470-27357492 GAATGATGGTAGTATTCTGATGG - Intronic
1094174959 12:27531799-27531821 GAATGAGGATAAGAGACAGGAGG - Intronic
1094196588 12:27756412-27756434 GATTGAGGCCAGGAGTCTGTAGG + Intergenic
1094639013 12:32255252-32255274 GGATGAGGCTATGAGGCTGGGGG - Intronic
1095247702 12:39942246-39942268 GAATGATGGTGGTAGTCTGATGG + Intronic
1096193599 12:49635072-49635094 GATAGAGGGTAGGAGTGGGGTGG - Intronic
1096719872 12:53513269-53513291 GAATGAGCGTAGGTGGCTGCTGG - Exonic
1097052708 12:56232863-56232885 GAATGAGGATGTGAGTCTGACGG + Exonic
1098949712 12:76627228-76627250 GAATGAGCAAAGGAGGCTGGAGG + Intergenic
1099364034 12:81745302-81745324 ACTGGAGGGTAGGAGTCTGGTGG + Intronic
1100649293 12:96567250-96567272 CAATAAGGGTAGGAGTCGGGTGG + Intronic
1101575495 12:105993353-105993375 GGAGTAGGGTGGGAGTCTGGAGG + Intergenic
1101581807 12:106048526-106048548 GAATTAGGGCTGGAGTCTTGTGG + Intergenic
1102136754 12:110582443-110582465 GAACGAGGTTAGGAGCCTGCAGG + Intronic
1102300505 12:111767496-111767518 GGATGAGGGCATGAGTCAGGGGG - Intronic
1102426614 12:112848864-112848886 GAGTGAGGGTATGTGTTTGGAGG + Intronic
1103205219 12:119123659-119123681 GAATAAGGCTAGGAATCTTGAGG + Intronic
1104332926 12:127864459-127864481 GAATGATGGTAGTATTTTGGTGG - Intergenic
1105837857 13:24226047-24226069 CAATGAGTGGCGGAGTCTGGGGG + Intronic
1107683553 13:42873653-42873675 GCATCAGGGAAGGAGGCTGGGGG - Intergenic
1108088429 13:46819605-46819627 GAGTGAAGGAAGGAGTATGGAGG + Intergenic
1109888120 13:68569252-68569274 GAATGAGGGATGGGGTCTGTAGG + Intergenic
1113338530 13:109399863-109399885 GAGTGAGGGTAGGGGACTGGGGG + Intergenic
1114843113 14:26289442-26289464 GACAGAGAGTAGGAGGCTGGAGG - Intergenic
1117437049 14:55726081-55726103 GACAGAGGGTAGGGGTCTGGAGG + Intergenic
1118128091 14:62931771-62931793 GAATTAGGGAAGGCATCTGGAGG - Intronic
1119425315 14:74531238-74531260 GAATCACTGTAGGAGGCTGGAGG + Intronic
1119653264 14:76398575-76398597 GAAGGAGGGTAGGGCTGTGGGGG + Intronic
1119657327 14:76426270-76426292 GAAGGAGGGCAGGAGTCTGTGGG + Intronic
1119824835 14:77648999-77649021 TAATGAGGGTAAAATTCTGGAGG + Intergenic
1120178811 14:81322712-81322734 GAGTGAGGGTATGAGTTGGGAGG - Intronic
1121446221 14:93980889-93980911 GAAGGAGGGAAGGAGAGTGGAGG + Intergenic
1121455921 14:94038811-94038833 GAACGAGGGTGGGAGGCTGAGGG + Intronic
1121550490 14:94795984-94796006 GAAGGAGGGTTGGAGGCAGGGGG + Intergenic
1122327317 14:100890492-100890514 GGAGGAGGGTGGGAGGCTGGGGG + Intergenic
1122986741 14:105215005-105215027 GAGTGGGGGTGGGAGTGTGGGGG + Intronic
1123055663 14:105568527-105568549 GTATGGGGCTGGGAGTCTGGAGG - Intergenic
1123080022 14:105688046-105688068 GTATGGGGCTGGGAGTCTGGAGG - Intergenic
1124784107 15:32663306-32663328 GACTGAGGGAAGGAGTAAGGAGG - Intronic
1125522163 15:40354402-40354424 GAAGGAGGCTAGGGGTCTGGAGG - Intronic
1126425755 15:48525486-48525508 GAATGTGTGTGGGAGTGTGGGGG + Intronic
1126435511 15:48633524-48633546 CAATGAGGGTATCAGTCAGGTGG - Intronic
1126687889 15:51264362-51264384 GAATGATGGCAGGAGTCGGGGGG + Intronic
1126860043 15:52874453-52874475 GAAAGAGGGTAGGAGTCACTTGG - Intergenic
1127245054 15:57164005-57164027 GATTGTGGGGAGGGGTCTGGTGG + Intronic
1128093879 15:64938435-64938457 GACTGGGGTTAGGAGTTTGGGGG - Intronic
1129317284 15:74752595-74752617 GAGCAAGGGTAGGATTCTGGTGG - Intronic
1129814411 15:78539604-78539626 GCTTGAGGCTAGGAGTTTGGAGG - Intergenic
1131957972 15:97757956-97757978 GAATGAGCCTAGGAGTTTGGAGG - Intergenic
1133002395 16:2857964-2857986 GAAGGAGGGAAGGAGGGTGGAGG + Intronic
1134250829 16:12572616-12572638 GAATGAAGGATGGATTCTGGGGG - Exonic
1136580802 16:31149801-31149823 GACGGAGGCTAGGAGGCTGGGGG - Intronic
1137447870 16:48543149-48543171 GAATCCGGGTCGGAGGCTGGTGG + Exonic
1137848250 16:51712890-51712912 GGATGAGGGTGGGTGACTGGGGG - Intergenic
1138191557 16:55017743-55017765 GAATGAGGGGAGGAGTACGGGGG + Intergenic
1139269474 16:65668398-65668420 GAGTGGGGGTAGGAGTCAGAGGG + Intergenic
1141208972 16:81958640-81958662 GATGGAGGGTAGGAATCTTGGGG + Exonic
1142694590 17:1626859-1626881 GAAGGAGGGTAGGAGGCTAGAGG + Intronic
1143344720 17:6241349-6241371 CAAGGAGGGTAGGAGCCAGGAGG - Intergenic
1144179500 17:12738735-12738757 GAGTGAGTGTAGGAATTTGGGGG - Intronic
1144761409 17:17709613-17709635 GAATGAGGCCAGGGGCCTGGGGG - Intronic
1146727950 17:35170903-35170925 AGATGAGGAAAGGAGTCTGGGGG - Intronic
1146941213 17:36845594-36845616 GAAGGTGGTTAGGACTCTGGAGG + Intergenic
1148071831 17:44913186-44913208 GAATGGGGGAAGGAGGGTGGAGG - Intronic
1148317049 17:46710702-46710724 TTATGAGGGTTTGAGTCTGGTGG + Intronic
1148438942 17:47701900-47701922 GAAGGAGGGGAGGAGCCAGGAGG - Intronic
1148516397 17:48222325-48222347 GAAAGAGTGTAGGAGTATGAAGG - Intronic
1149344452 17:55720528-55720550 GAATGGGGGTGGGAGGGTGGAGG - Exonic
1150284588 17:63947764-63947786 GATTGAGGGTCTGACTCTGGGGG + Intronic
1152022625 17:77788595-77788617 GGATGTGGGGAGGAGGCTGGGGG + Intergenic
1152370740 17:79887035-79887057 GAATGAGGAGAGGAGGCTGGGGG + Intergenic
1152370757 17:79887091-79887113 GAATGAGGAGAGGAGGCTGGGGG + Intergenic
1152701076 17:81820008-81820030 GCAGGAGGGTAGGAGTCTGTGGG - Intergenic
1152762476 17:82116279-82116301 GAGTGAGGGTGGGAGGCAGGGGG + Intronic
1152922300 17:83072242-83072264 GAGTCAGGGCAGGAGGCTGGGGG - Intergenic
1156399516 18:36728002-36728024 GAATGGAGATAGGGGTCTGGAGG - Intronic
1156438014 18:37154547-37154569 GAATGATGGTAGGAGTTATGGGG - Intronic
1156953295 18:42931251-42931273 GAATGAGGATTGGAGGCTGGAGG + Intronic
1157678178 18:49583072-49583094 GGAAGAGGCTAGGAGTTTGGGGG + Intronic
1158577264 18:58649076-58649098 GAATGAGGCTTGGGGTCAGGAGG - Intergenic
1159055549 18:63459660-63459682 GCATGGGGGTAGGAGGATGGAGG + Intergenic
1159107353 18:64017776-64017798 GAAAGAAGGTAGGAGGCTGATGG - Intergenic
1160696024 19:484908-484930 GACTGAGGGTAGGAAGGTGGGGG + Intergenic
1160962870 19:1731840-1731862 AAAGGAGGGTAGGAGTGGGGAGG + Intergenic
1163446989 19:17352757-17352779 GAACCAGTGTAGGGGTCTGGGGG - Intronic
1163478600 19:17541114-17541136 GAATGGGAGGAGGAGTTTGGGGG - Intronic
1163488465 19:17603415-17603437 GGCTGAGGGTAGGGGTCGGGTGG - Exonic
1163700589 19:18784790-18784812 GTATGAGGCTAGGGGGCTGGGGG + Intronic
1164691145 19:30211618-30211640 GAATTAGAGGAGGGGTCTGGTGG - Intergenic
1165306002 19:35003415-35003437 GAGTGAAGGGAGGAGCCTGGGGG - Intronic
1165858698 19:38895217-38895239 GACTGAGGCTGGGAGGCTGGGGG - Intronic
1166373329 19:42314122-42314144 GGATCAGGGAAGGAGTTTGGAGG + Intronic
1166895388 19:46019112-46019134 GAAGGAGGGGAGGTGTGTGGTGG + Intronic
1168146058 19:54420651-54420673 GAATGTGGGAGGGAGGCTGGAGG - Intronic
926343301 2:11922679-11922701 GAAGAAGGGCAGGAGCCTGGAGG + Intergenic
926693458 2:15753871-15753893 GAATGGGGGTAGGAGACTTTCGG - Intergenic
927109795 2:19856404-19856426 GAGTGAGGTCAGGAGGCTGGTGG - Intergenic
927446990 2:23171808-23171830 GTATGAGGGTGGGAGTATGAGGG - Intergenic
928908161 2:36390441-36390463 GAATGAGCTTCGGAGTGTGGAGG - Intronic
929601241 2:43206134-43206156 GTAGGAGGGCAGGAGCCTGGAGG + Intergenic
930323114 2:49880388-49880410 GGAGGAGGTTAGGAGTCTTGTGG - Intergenic
932374761 2:71226406-71226428 GAATGAGGGCTGGAGTCAAGGGG + Intronic
932815732 2:74860165-74860187 GGGTGAGGGTAGGAGGGTGGGGG + Intronic
932815742 2:74860188-74860210 GCATGAGGGTAGGAGGGTGGGGG + Intronic
933997480 2:87680354-87680376 GTATGGGGATAGGATTCTGGAGG + Intergenic
936296372 2:111270558-111270580 GTATGGGGATAGGATTCTGGAGG - Intergenic
936483833 2:112909696-112909718 GAATGAGGATGTGAGTGTGGGGG - Intergenic
937276708 2:120689384-120689406 GAGTCAAGGTAGAAGTCTGGAGG + Intergenic
941388125 2:164878326-164878348 GAATGAGGGGACGAGTCCAGAGG - Intergenic
941919303 2:170833163-170833185 GACTGAGACTAGGAGGCTGGTGG + Intronic
942478855 2:176359908-176359930 GAGTGAAGGTAGGAGTCAGGGGG - Intergenic
943855281 2:192782650-192782672 GAATGAGTGTAGGAGACTGGTGG + Intergenic
945517484 2:210780259-210780281 GAATAAAAGCAGGAGTCTGGTGG + Intergenic
946201055 2:218070985-218071007 GAGTGAGGTTAGGTGTCAGGAGG - Intronic
947714859 2:232334328-232334350 GCATGAGAGTGGGAGCCTGGGGG - Intronic
948083473 2:235226807-235226829 GAATGTGGGAAGGCGCCTGGAGG - Intergenic
948653830 2:239464771-239464793 AAGTGAGGGGAGGAGCCTGGCGG + Intergenic
1168751125 20:282241-282263 GAATAAGGTTAGGGGGCTGGAGG - Intronic
1170134109 20:13054203-13054225 GAATGAGAGTGGGAGTATGTGGG + Intronic
1170180662 20:13526143-13526165 AAATAAGGGTAGGGGACTGGTGG + Intronic
1171041246 20:21765716-21765738 GAAGGAGGGTGAGAGGCTGGTGG + Intergenic
1171389192 20:24790250-24790272 GAGTGAGGGGAGGAGTGAGGGGG + Intergenic
1172819519 20:37718879-37718901 GACTGAGGAAAGGAGTCTTGAGG + Intronic
1173142693 20:40498265-40498287 CAATGAGGGAAAGAGTCTGGAGG + Intergenic
1173749764 20:45468179-45468201 CAATGAGGGCAGGAGCCAGGTGG - Intergenic
1173894309 20:46538702-46538724 GTATGAGGGAAGGAGCATGGTGG - Intergenic
1177893139 21:26831463-26831485 CAATGAGGATAGGAGGTTGGTGG - Intergenic
1178191422 21:30285905-30285927 TAATGAGGAAAGGAGTCTGCTGG - Intergenic
1179981252 21:44897099-44897121 GGATGGGGGCAGGTGTCTGGGGG - Intronic
1181435472 22:22907952-22907974 GTGTGAGGGTAGGACTCAGGTGG + Intergenic
1181904455 22:26182992-26183014 GAAACAGGGAAGGAGTCTGGTGG - Intronic
1183130855 22:35834542-35834564 GAATGAAGGTAGGAGTGATGAGG + Intronic
1183251536 22:36733700-36733722 GGATGAGGGAAGGAGTCCCGAGG - Intergenic
1183438216 22:37807675-37807697 GAATGCGGTGGGGAGTCTGGTGG + Intergenic
1183747014 22:39697867-39697889 GAATGAGGAATGGAGGCTGGGGG + Intergenic
1184378553 22:44130725-44130747 GAATGAAAGTGGGAGTCAGGAGG - Intronic
1185301896 22:50085488-50085510 CAATGAGGGGAGGAATCGGGTGG + Exonic
1185427660 22:50782419-50782441 CACTGAGGGAAGCAGTCTGGAGG - Intronic
950649076 3:14396061-14396083 GAATGGGGGTGGGAGCGTGGGGG + Intergenic
950653551 3:14422721-14422743 GAGTGAGGGTAGGGATTTGGAGG - Intronic
950719217 3:14870617-14870639 GAATGAAGGATGGGGTCTGGGGG - Intronic
951477657 3:23125659-23125681 GAATCAGGACAAGAGTCTGGAGG + Intergenic
951614088 3:24522347-24522369 GACTGAGGTTAGGTGTCCGGTGG + Intergenic
951871506 3:27367780-27367802 GAGTGAGAGCAGGAGTGTGGGGG + Intronic
952264837 3:31775369-31775391 GAAAGAGGATAGGACTCTAGAGG + Intronic
952684089 3:36130065-36130087 AAAGGAGGGAAGGTGTCTGGGGG - Intergenic
953848748 3:46449435-46449457 GGCTGGGGGTGGGAGTCTGGGGG - Intronic
953875138 3:46662388-46662410 GAAAGGGGGTAGGAGTCATGAGG + Intergenic
954393265 3:50278730-50278752 GGCTGTGGGTAGGAGTCTGCAGG + Intergenic
954436963 3:50501380-50501402 GAATGAGGGTGGGGGTGGGGTGG - Intronic
954618161 3:51980829-51980851 GGATAAGGGTTGGAGTCTGCAGG - Exonic
954656774 3:52198631-52198653 AAATGAGGGTAGGGGTATGAGGG - Intronic
955024783 3:55157014-55157036 GAATGAGTGTGGGATTCTGAAGG - Intergenic
956707953 3:72015621-72015643 GAAAGAGGGGCGGAGGCTGGGGG - Intergenic
956751030 3:72344070-72344092 AAATGTGGGTAGGTGTATGGGGG - Intergenic
959778459 3:110199608-110199630 GCATGAGGGTGGGATGCTGGTGG - Intergenic
960101304 3:113746107-113746129 GAGTGAGGGCTTGAGTCTGGTGG + Exonic
961198892 3:125028181-125028203 GCATGGGGGTAGGAGGATGGAGG - Intronic
961748461 3:129081278-129081300 GAATGAGGGGAGGTGACTGTGGG + Intergenic
962693030 3:137920080-137920102 GAATGAGGGCATGAATCTGTTGG - Intergenic
963599395 3:147364749-147364771 GACTGGGAGTAGGAGTCTGAAGG + Intergenic
963641230 3:147863582-147863604 GTATGAGGGGAGAAGTCTGAGGG - Intergenic
966479981 3:180396606-180396628 GGATTAGAGTTGGAGTCTGGGGG + Intergenic
966862264 3:184237059-184237081 GAATGAGGGTAGGAGCAAGCAGG - Intronic
967010756 3:185431144-185431166 GAGTCAGGGGAGGGGTCTGGTGG - Intronic
967348037 3:188480513-188480535 GGATGAGTGGAGGAGTATGGAGG + Intronic
971182746 4:24345295-24345317 GAATGATGGTAGTATTCTGATGG + Intergenic
971512798 4:27447918-27447940 AAGTGAGGGTTGAAGTCTGGGGG + Intergenic
973861314 4:55068195-55068217 GCATGGGGTTAGCAGTCTGGAGG - Intergenic
975322356 4:73023180-73023202 GAAGGAGGGAGGGAGGCTGGTGG - Intergenic
976537478 4:86235230-86235252 GAATGAGGATAGGAATGTGTGGG - Intronic
977774166 4:100897522-100897544 GTATTAGGGAAGGAGGCTGGGGG + Intergenic
978130877 4:105195855-105195877 GAATCTTGGTAGGAGTCTTGGGG + Intronic
981625586 4:146750596-146750618 GAAGGAGGGTATAAGTCTAGAGG + Intronic
983281034 4:165681034-165681056 GCACGAGGCTAGGAGTGTGGAGG + Intergenic
984226345 4:177039872-177039894 GCAAGAGGGCAGGAGCCTGGGGG + Intergenic
986081521 5:4399365-4399387 GAATGAGGGTGGGGGTGTGAAGG + Intergenic
987059212 5:14226039-14226061 GAGTGAGGGTGGGAGGTTGGAGG + Intronic
988722945 5:33896714-33896736 GAATGATGGTAGAAGTGGGGAGG + Intergenic
990347547 5:54884474-54884496 GAGTGAGGGCAGCAGGCTGGAGG + Intergenic
990773123 5:59273180-59273202 GAATGAGGGTAGGGTGGTGGTGG + Intronic
992005477 5:72473189-72473211 GAATGTGGATATGAGGCTGGAGG + Intronic
995852982 5:116565900-116565922 CAAGGACAGTAGGAGTCTGGGGG + Intronic
997536991 5:134630160-134630182 AAATGAGTGTAGAAGGCTGGGGG + Intronic
998148165 5:139742156-139742178 GAGTGTGGGTGGGAGCCTGGAGG + Intergenic
998559098 5:143154572-143154594 GATTCAAGGTAGGAGGCTGGTGG - Intronic
998650795 5:144119100-144119122 GAAGGAGTGAAGGAGGCTGGTGG + Intergenic
998946195 5:147341918-147341940 CAATGAAGGGAGTAGTCTGGTGG + Intronic
1000516209 5:162238636-162238658 GAATGACAACAGGAGTCTGGTGG - Intergenic
1001193656 5:169652789-169652811 GAATGAGAGTTAGAGACTGGCGG + Intronic
1001397875 5:171429629-171429651 GAATGTGGCTGGAAGTCTGGGGG + Intronic
1001848336 5:174941036-174941058 AAGTGATGGGAGGAGTCTGGAGG + Intergenic
1002064595 5:176645773-176645795 GAATGAGGGTAGGAGTCTGGTGG + Intronic
1002180649 5:177429399-177429421 AACTGAGGGTGGGAGGCTGGCGG + Intronic
1002869200 6:1150682-1150704 GACTGAGTGGAGGTGTCTGGAGG - Intergenic
1005184617 6:23151207-23151229 GAATGAGGGAAGGAGGCTCCAGG - Intergenic
1006334532 6:33413634-33413656 GGATGAGGGTAGCACTCAGGGGG + Intronic
1006650169 6:35544952-35544974 GAAGGAGGGCAGGAGGGTGGAGG + Intergenic
1007787169 6:44287327-44287349 CAGTGTGGGTGGGAGTCTGGTGG + Intronic
1008507789 6:52247444-52247466 GAATGAGGGGAGGAGACGGTGGG + Intergenic
1008674716 6:53807270-53807292 GAATGAGGGAAGGAGGAGGGAGG - Intronic
1009345687 6:62611073-62611095 GTATTAGGGGAGGGGTCTGGTGG - Intergenic
1010232832 6:73550719-73550741 TAAAGAGTGGAGGAGTCTGGCGG + Intergenic
1012029832 6:94044882-94044904 GACTGAGGGTAGGGGAATGGAGG + Intergenic
1012439831 6:99252821-99252843 GAAAGAGGGGAAGATTCTGGGGG - Intergenic
1012890249 6:104888949-104888971 GAATGAGAATAGGAGTGAGGTGG + Intergenic
1013438922 6:110141255-110141277 AAATGAGGGTAGAAGTGAGGAGG - Intronic
1013813836 6:114074140-114074162 GTTTGGGGGTAGGAGGCTGGGGG + Intronic
1020122584 7:5513460-5513482 GAGACAGGGTAGGAGTCTTGGGG + Intronic
1020750736 7:12138347-12138369 GATTGAATGTGGGAGTCTGGGGG - Intergenic
1022470884 7:30681435-30681457 GGAGGAGGGTAGGAGGCAGGAGG - Intronic
1023126370 7:36958448-36958470 GAGGGAGGGAAGGACTCTGGAGG - Intronic
1024275152 7:47671406-47671428 GAGTGAGGGGAGGGCTCTGGGGG + Intergenic
1026477860 7:70752140-70752162 GAATCGCGGAAGGAGTCTGGGGG + Intronic
1027229689 7:76265036-76265058 GAAGGAGGGTGGGAGTCACGAGG - Intronic
1029381954 7:100220557-100220579 GAATGGGGGCAGGAGTCGGCGGG - Exonic
1029402116 7:100353007-100353029 GAATGGGGGCAGGAGTCGGCGGG - Exonic
1031282961 7:119828136-119828158 GGATGAGGGTAGGAGGATGTAGG + Intergenic
1032013991 7:128364677-128364699 GGATGGGGGTAGGAGGTTGGTGG - Intergenic
1032154778 7:129458846-129458868 GAATGAGGGATGGTGCCTGGTGG + Intronic
1032735818 7:134692020-134692042 GAATGCAAGTAGGAGCCTGGGGG + Intergenic
1033816778 7:145083139-145083161 GAATCAGGGGAGTAGTGTGGGGG - Intergenic
1033998615 7:147385172-147385194 GAGTCAGGGAAGGAATCTGGTGG - Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034315471 7:150127228-150127250 CAATAGGGGTGGGAGTCTGGTGG - Intergenic
1037690232 8:21175728-21175750 GAGTGAGGGTATGAGTTTGGGGG + Intergenic
1037992828 8:23332783-23332805 GAGTGTGGGTATGAGTGTGGGGG - Intronic
1038331151 8:26610569-26610591 GATTGAGGGAAGGAGGGTGGAGG - Intronic
1038914837 8:32009554-32009576 GAAAGAGGGTAGGGTTTTGGGGG + Intronic
1041476502 8:58272847-58272869 AAATGAGGGTAGAAGTCAGCGGG + Intergenic
1044858583 8:96499348-96499370 GAATGGGGGTGGGAGTGTGGGGG + Intronic
1046174241 8:110553891-110553913 GAATGAGGGAAGGTGTGAGGTGG - Intergenic
1047863927 8:129000884-129000906 GATTAAGGGCAGTAGTCTGGTGG + Intergenic
1048400595 8:134065246-134065268 GAATGAGGGTATGCATCTTGAGG + Intergenic
1049032025 8:140045139-140045161 GAAGGAGGTGAGGAGTCTGAAGG + Intronic
1050052696 9:1619797-1619819 GAATCAGGGACGGGGTCTGGGGG + Intergenic
1050675928 9:8053208-8053230 GCATGAGGGCAGGATGCTGGTGG + Intergenic
1052108501 9:24549430-24549452 GAATGAGGGGAGGAGGGTAGCGG + Intergenic
1052857344 9:33415533-33415555 GGATGAGGTTGGGAGTCTGGGGG - Intergenic
1053067224 9:35077199-35077221 GAGAGAGGGCATGAGTCTGGAGG + Intronic
1056075848 9:83039384-83039406 GAATGAAGGAAGGAGGCAGGAGG + Intronic
1056631094 9:88293752-88293774 GAAGGGGGGCAGGAGTCTTGTGG - Intergenic
1056801099 9:89692353-89692375 GAATGAGGCTATGGGCCTGGAGG + Intergenic
1057048906 9:91907265-91907287 TAATGTGAGGAGGAGTCTGGGGG - Intronic
1058758724 9:108108402-108108424 GAGTGAAGGGAGGAGTCTGTGGG + Intergenic
1059703627 9:116799689-116799711 GAATGTGGGTAAGAGAGTGGGGG + Intronic
1062106956 9:134760630-134760652 GCATGAGTGTATGAGTGTGGGGG - Intronic
1062155903 9:135048431-135048453 AAATGAGGGGAGGAGTGAGGCGG - Intergenic
1186471372 X:9824653-9824675 GAATGAGGGTGGAAAGCTGGAGG + Intronic
1186520970 X:10206543-10206565 GAATGAGGGCAAGAGGCGGGAGG + Exonic
1186637023 X:11417322-11417344 GGATGAGGGCAGGAGTAGGGTGG + Intronic
1187048855 X:15675964-15675986 GAATGGGAGTGGGAGGCTGGCGG + Intergenic
1188396331 X:29688033-29688055 GAATGAGGGTGGGAGTGAGGTGG + Intronic
1188771281 X:34157659-34157681 GCATGAGGGCAGGGTTCTGGTGG + Intergenic
1189320093 X:40082646-40082668 GAGTGAGGGTGGGAGCCGGGAGG - Intronic
1189626285 X:42900542-42900564 GAATGAGCTTAGAAGTCTGCAGG - Intergenic
1194792172 X:98163909-98163931 GGATGAGGTGAGGAGTCAGGAGG + Intergenic
1195576088 X:106452152-106452174 GCAGGAGGGTGGGAGCCTGGAGG - Intergenic
1197159167 X:123304512-123304534 GAATAAGAGAAGGAGCCTGGAGG - Intronic
1201929968 Y:19332843-19332865 CAATGAGGGTAAGTGTCTTGAGG + Intergenic