ID: 1002065640

View in Genome Browser
Species Human (GRCh38)
Location 5:176650420-176650442
Sequence TGCCCCGGGGATTGGTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002065640_1002065658 22 Left 1002065640 5:176650420-176650442 CCTCTGGACCAATCCCCGGGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1002065658 5:176650465-176650487 AAGGAGCTCGGGGAGGAATGGGG No data
1002065640_1002065651 10 Left 1002065640 5:176650420-176650442 CCTCTGGACCAATCCCCGGGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1002065651 5:176650453-176650475 GAGCATCCTGGGAAGGAGCTCGG 0: 1
1: 1
2: 2
3: 39
4: 373
1002065640_1002065650 3 Left 1002065640 5:176650420-176650442 CCTCTGGACCAATCCCCGGGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1002065650 5:176650446-176650468 GAAGGCGGAGCATCCTGGGAAGG 0: 1
1: 0
2: 0
3: 28
4: 207
1002065640_1002065657 21 Left 1002065640 5:176650420-176650442 CCTCTGGACCAATCCCCGGGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1002065657 5:176650464-176650486 GAAGGAGCTCGGGGAGGAATGGG 0: 1
1: 0
2: 0
3: 36
4: 275
1002065640_1002065648 -2 Left 1002065640 5:176650420-176650442 CCTCTGGACCAATCCCCGGGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1002065648 5:176650441-176650463 CAGGTGAAGGCGGAGCATCCTGG 0: 1
1: 0
2: 1
3: 18
4: 176
1002065640_1002065656 20 Left 1002065640 5:176650420-176650442 CCTCTGGACCAATCCCCGGGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1002065656 5:176650463-176650485 GGAAGGAGCTCGGGGAGGAATGG No data
1002065640_1002065652 11 Left 1002065640 5:176650420-176650442 CCTCTGGACCAATCCCCGGGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1002065652 5:176650454-176650476 AGCATCCTGGGAAGGAGCTCGGG 0: 1
1: 0
2: 1
3: 32
4: 317
1002065640_1002065649 -1 Left 1002065640 5:176650420-176650442 CCTCTGGACCAATCCCCGGGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1002065649 5:176650442-176650464 AGGTGAAGGCGGAGCATCCTGGG No data
1002065640_1002065654 15 Left 1002065640 5:176650420-176650442 CCTCTGGACCAATCCCCGGGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1002065654 5:176650458-176650480 TCCTGGGAAGGAGCTCGGGGAGG 0: 1
1: 0
2: 5
3: 40
4: 388
1002065640_1002065653 12 Left 1002065640 5:176650420-176650442 CCTCTGGACCAATCCCCGGGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1002065653 5:176650455-176650477 GCATCCTGGGAAGGAGCTCGGGG 0: 1
1: 0
2: 0
3: 15
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002065640 Original CRISPR TGCCCCGGGGATTGGTCCAG AGG (reversed) Intronic
900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG + Intronic
900809390 1:4789935-4789957 TGGCCCGGGGATTGGTACAATGG - Exonic
902447110 1:16474425-16474447 GGCCCAGGGGGTTGGCCCAGTGG - Intergenic
903632948 1:24790690-24790712 TGCCCCTGGGATGGGGTCAGAGG - Intronic
904370752 1:30046047-30046069 ACCCCAGGGGATTGGGCCAGAGG - Intergenic
904797625 1:33069354-33069376 TGCCCTGGGGCTGGGTGCAGTGG + Intronic
905684874 1:39901251-39901273 GGCCCCCGGGATTGGTCCCCCGG - Exonic
908963812 1:69732919-69732941 TGGCCCAGGAATTGATCCAGAGG + Intronic
913338633 1:117734149-117734171 TGGCCCAGGGACTGGCCCAGTGG - Intergenic
914379713 1:147105223-147105245 TGCCCCAGGGATTGGTTTTGTGG + Intergenic
920250371 1:204618840-204618862 TGCCCGTGGCATTGGCCCAGCGG + Exonic
923651325 1:235876887-235876909 AGCCCCAGGCATTGGTTCAGAGG + Intronic
1067054338 10:43042316-43042338 TGCCCTGGGGAATGGTCCCATGG - Intergenic
1067787482 10:49260981-49261003 TGCCATGGGGATTGGTCCCAAGG + Intergenic
1070722107 10:78764093-78764115 TGCCCCAGGGAAGGGTTCAGAGG - Intergenic
1076555718 10:131320282-131320304 TGCCCCAGGGACTGGTCCCAAGG - Intergenic
1076667518 10:132101681-132101703 TGGCCCGGGGCTCGGTCCTGGGG + Intergenic
1076745205 10:132509529-132509551 TGCCCAGGGGCTGGGTCAAGTGG + Intergenic
1077111513 11:864163-864185 TGCCCCAGGGATGGGGGCAGGGG + Intronic
1077251916 11:1564514-1564536 TGCCTCCGGAATTGGTGCAGGGG - Intronic
1078266315 11:9758402-9758424 TGCCCCGGGGTTCTGTCCACCGG + Intergenic
1088535096 11:110851925-110851947 TTCTCCGGGGATTGGTTTAGAGG + Intergenic
1088894025 11:114064424-114064446 TGCCCCAGGGCTTCATCCAGAGG + Exonic
1089502230 11:118939557-118939579 TGCCATGGTGATGGGTCCAGAGG + Intronic
1089603086 11:119626950-119626972 TGGCCTGGGGATGGGGCCAGGGG + Intronic
1089786420 11:120910615-120910637 GGCCCCTGGGATTAGTCCTGGGG - Intronic
1090183448 11:124720274-124720296 TGACCCAGGGAGTTGTCCAGGGG + Intergenic
1094090494 12:26644234-26644256 TGCCCCAGGTATGGCTCCAGTGG + Intronic
1098161392 12:67649834-67649856 TTCCCCGGGGCTCGGTGCAGGGG + Exonic
1102176581 12:110880089-110880111 TGGGCTGGGGATAGGTCCAGGGG + Intronic
1113372096 13:109733613-109733635 TGCCCCGGGGACTCATTCAGGGG - Intergenic
1113942793 13:114027150-114027172 AGCCCTGGGGATTGGACCCGTGG - Intronic
1117533934 14:56686518-56686540 TGCACCGGCTATTGTTCCAGAGG + Intronic
1119424667 14:74527767-74527789 TGCCCTGGGCTTTGGGCCAGGGG + Intronic
1119619811 14:76123701-76123723 GGCCACAGGGATTGGTTCAGGGG + Intergenic
1121583132 14:95045455-95045477 CACCACGGGGAGTGGTCCAGGGG + Intergenic
1122309449 14:100785290-100785312 TGCCCCTTGGATTGGTCACGGGG - Intergenic
1129452980 15:75661087-75661109 GGCCCAGAGGATTGGCCCAGGGG - Exonic
1129666417 15:77581997-77582019 TGTCCCGGGGGTGGGTGCAGCGG - Intergenic
1132601845 16:776259-776281 AGCCCCGGGGAATGGAGCAGGGG + Intronic
1138659756 16:58510088-58510110 TGCCCTGGAGATAGCTCCAGAGG - Intronic
1142028119 16:87825161-87825183 TGCCCCGGAGTTCTGTCCAGTGG + Intergenic
1142126069 16:88411344-88411366 AGCCCCGGCGGGTGGTCCAGGGG + Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143514281 17:7411594-7411616 TGCCCTGCAGAGTGGTCCAGAGG + Intronic
1145367813 17:22279086-22279108 TGCAGCAGGGATTCGTCCAGCGG + Intergenic
1147555799 17:41478312-41478334 TGCTCCTCGGCTTGGTCCAGAGG + Intronic
1149711946 17:58751298-58751320 TTCACCTGGGATTTGTCCAGTGG - Intergenic
1152588126 17:81198135-81198157 TGCCCCTGTGATGGGTCCTGGGG + Exonic
1157213297 18:45761940-45761962 GGCCATGGGGATTGGTCCAAGGG + Intergenic
1157745862 18:50134738-50134760 TGCCCTGGGGATTGCTCACGAGG + Intronic
1160510302 18:79449766-79449788 AGCCCCGGGGGTGGGTGCAGAGG + Intronic
1162954961 19:14092387-14092409 TTCCCCGGGGAGGGGCCCAGGGG + Exonic
1164721036 19:30431740-30431762 TGCCCCAGGGAGGGGTCCTGCGG + Intronic
1165892325 19:39121192-39121214 TGTCCCTGGGATTGTTCCAGGGG + Intergenic
1166928909 19:46289222-46289244 TGCCCCTGGCAGTGTTCCAGGGG + Intergenic
1167048981 19:47067428-47067450 TGCCCGGGGAGTGGGTCCAGGGG + Exonic
925877093 2:8320843-8320865 TGCCCCTGGGAGTGGAGCAGAGG + Intergenic
934617829 2:95785859-95785881 AGCCACAGGGATTGGTCAAGAGG + Intergenic
934643064 2:96038700-96038722 AGCCACAGGGATTGGTCAAGAGG - Intronic
936019392 2:108983483-108983505 GGCCACGGGGAATGCTCCAGTGG - Intronic
936517401 2:113191065-113191087 TGCCCCGTGGAGAGGTTCAGAGG - Intronic
936885117 2:117300598-117300620 TCCCCCAGGGGTGGGTCCAGAGG - Intergenic
937336458 2:121065390-121065412 TGGCCCAGGGACAGGTCCAGTGG + Intergenic
945386695 2:209209630-209209652 GTCCTCGGGGAGTGGTCCAGAGG + Intergenic
946185674 2:217979093-217979115 TGCCCCTGGCAGGGGTCCAGTGG - Intronic
948826182 2:240574382-240574404 GGCCCTGGGCACTGGTCCAGGGG + Intronic
1172097356 20:32466954-32466976 TGACCCAGGGATGGGCCCAGGGG + Intronic
1172340974 20:34157370-34157392 GGGCCCGCAGATTGGTCCAGGGG - Intergenic
1180103203 21:45599533-45599555 TGTCCCAGGAATTGTTCCAGGGG - Intergenic
952557680 3:34551473-34551495 TGCCGCCGTGAGTGGTCCAGTGG + Intergenic
954137422 3:48588448-48588470 TGGGCCTGGGATTGGTGCAGGGG - Intronic
961169680 3:124788188-124788210 TCCCCCGGGGCTGGGTGCAGTGG - Intronic
962280738 3:134049867-134049889 TGCCCAGGTGAGAGGTCCAGAGG - Intronic
968959275 4:3734750-3734772 AGCCACGGGGATTGCCCCAGAGG - Intergenic
985382915 4:189414166-189414188 GACCCTGGGGATTGGTCTAGAGG - Intergenic
990809456 5:59706143-59706165 TGCCCTGGGGATTGGCCATGTGG + Intronic
995241035 5:109885384-109885406 TGGCCAGGGGCTTGGTCCCGGGG - Intergenic
995379138 5:111512586-111512608 AGCCCCCGGGATCGGGCCAGGGG - Intronic
1002065640 5:176650420-176650442 TGCCCCGGGGATTGGTCCAGAGG - Intronic
1002066071 5:176652362-176652384 GCCTCCAGGGATTGGTCCAGAGG - Intronic
1006027481 6:31156833-31156855 TGGCCTGGGGGTTGGACCAGGGG + Exonic
1013375277 6:109508807-109508829 TCCCCCAGGGGCTGGTCCAGTGG - Intronic
1013626602 6:111943862-111943884 TGCCCCAGGGAGTGGGGCAGGGG - Intergenic
1014535597 6:122610253-122610275 TGCCCCGGGGAGTGATGCGGTGG + Intronic
1016741428 6:147533149-147533171 TGCCCCGGGGCTTGGTGGATTGG - Intronic
1029513670 7:101012703-101012725 TCCCACGGGCATTGGCCCAGGGG + Intronic
1029815027 7:103084862-103084884 TGCCCCGGAGATTGATCCAAAGG - Intronic
1034116885 7:148591462-148591484 TGCCCTGGAGATGGGTCCACAGG + Intronic
1034385440 7:150737153-150737175 TGCCCCGGTGATGGGTGCTGAGG + Intronic
1037581714 8:20249473-20249495 TTCCCAGGAGATGGGTCCAGGGG - Exonic
1040858427 8:51974014-51974036 TGCCATGGGGATAGGTGCAGAGG + Intergenic
1042695159 8:71547630-71547652 TGCCCCGGGGTGGGGCCCAGGGG + Exonic
1049244971 8:141557538-141557560 GGTCTCGGGGATTGGGCCAGTGG - Intergenic
1062021114 9:134319854-134319876 TGCCCCGAGGAGTGGTGCCGGGG + Intronic
1187251064 X:17598244-17598266 GGCTCCGGGCATTGGTCCAGAGG - Intronic