ID: 1002067426

View in Genome Browser
Species Human (GRCh38)
Location 5:176658949-176658971
Sequence GGGCCAAGGAGCCACATTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002067426_1002067429 -5 Left 1002067426 5:176658949-176658971 CCAGCAATGTGGCTCCTTGGCCC 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1002067429 5:176658967-176658989 GGCCCCGCTGGCCAGTGTCCTGG 0: 1
1: 0
2: 3
3: 18
4: 228
1002067426_1002067435 7 Left 1002067426 5:176658949-176658971 CCAGCAATGTGGCTCCTTGGCCC 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1002067435 5:176658979-176659001 CAGTGTCCTGGGCCCCTGACAGG 0: 1
1: 0
2: 1
3: 22
4: 291
1002067426_1002067441 23 Left 1002067426 5:176658949-176658971 CCAGCAATGTGGCTCCTTGGCCC 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1002067441 5:176658995-176659017 TGACAGGCGCTGGCTGTGAGTGG 0: 1
1: 0
2: 1
3: 24
4: 189
1002067426_1002067437 13 Left 1002067426 5:176658949-176658971 CCAGCAATGTGGCTCCTTGGCCC 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1002067437 5:176658985-176659007 CCTGGGCCCCTGACAGGCGCTGG 0: 1
1: 0
2: 4
3: 43
4: 666
1002067426_1002067430 -4 Left 1002067426 5:176658949-176658971 CCAGCAATGTGGCTCCTTGGCCC 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1002067430 5:176658968-176658990 GCCCCGCTGGCCAGTGTCCTGGG 0: 1
1: 0
2: 2
3: 13
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002067426 Original CRISPR GGGCCAAGGAGCCACATTGC TGG (reversed) Exonic
900881597 1:5385605-5385627 AGGTCAAGGTGCCACATGGCTGG + Intergenic
902557930 1:17257997-17258019 GGACTGAGGAGCCACATGGCTGG + Intronic
905422976 1:37860603-37860625 GGGCCAAAGAGACATATTCCTGG - Intergenic
907515378 1:54990396-54990418 GGGCCGAGAAGACACATTGCCGG + Intronic
917978222 1:180253748-180253770 GGGTCAAGGGGCCACACGGCAGG - Intronic
921094351 1:211874291-211874313 GGGACTAGGAGCCACAGAGCAGG + Intergenic
1063187941 10:3667137-3667159 GGGCAGAAGAGCCACAATGCAGG - Intergenic
1064205587 10:13321122-13321144 GGGGCAAGGGACCACAGTGCTGG - Intronic
1064315505 10:14251715-14251737 GGGCCCTGGAGCCAGATTCCTGG + Intronic
1065077769 10:22098218-22098240 TGGCCAAGAGGCCACATTGGAGG - Intergenic
1067319558 10:45205265-45205287 TGGCCAAGGATCCGCACTGCTGG + Intergenic
1070824683 10:79384323-79384345 GGGCCAAGGTCCCCCATGGCCGG + Exonic
1072703521 10:97662652-97662674 GGGAAAAGAAGCCACAGTGCTGG + Intronic
1074510877 10:114110741-114110763 GGGCAATGGAGGCACATTCCAGG - Intergenic
1074839694 10:117337766-117337788 GGGCAAGGGAGCTACTTTGCTGG - Intronic
1075255897 10:120925949-120925971 AGGCCAGGCAGCCAGATTGCCGG - Intergenic
1076136606 10:128049484-128049506 GGGCCATTTAGCCACATTCCTGG - Intronic
1078393063 11:10953129-10953151 GGGCCAGGGTGCCAGATGGCTGG + Intergenic
1078449284 11:11428338-11428360 GGGTCAAGGAACCCCATTCCTGG + Intronic
1080266637 11:30408237-30408259 CTGTCAAAGAGCCACATTGCAGG + Intronic
1084163875 11:67366159-67366181 GGGCCTGGAAGCCAGATTGCAGG + Intronic
1084615201 11:70231275-70231297 GGGCCACTGAGCCACACTTCCGG + Intergenic
1087519610 11:99215069-99215091 GTGCCAAGGAGCCACATACTTGG - Intronic
1088557975 11:111082457-111082479 GGGTCATGGAGCCACCTTTCAGG + Intergenic
1089201225 11:116725796-116725818 GGGCGATGGAGCCACTCTGCAGG - Intergenic
1096526085 12:52211194-52211216 GGGCCAAGGAGACACTCAGCCGG - Intergenic
1096974446 12:55691844-55691866 GAGCCAAGGAGACCCTTTGCAGG - Intronic
1097165742 12:57085758-57085780 AGGCCAAGGAGCCAGATTTGTGG + Intronic
1097803414 12:63939793-63939815 GAGCCATGGAGCCACCTTCCAGG - Intronic
1101954553 12:109201698-109201720 GGGCCGTGGAGCCACATACCGGG - Exonic
1102585592 12:113920565-113920587 GGGCCACGGAGGCACTTGGCAGG - Intronic
1103855937 12:123972057-123972079 GGGCGAGGGATCCGCATTGCAGG - Intronic
1104080478 12:125425958-125425980 GTGCCAAGGAGCGCAATTGCTGG + Intronic
1105330405 13:19410650-19410672 GGCCAAAGGGGCCACACTGCAGG + Intergenic
1107481964 13:40792645-40792667 GGCTGAAGGAGCCACACTGCAGG + Intronic
1108067589 13:46594109-46594131 GAGCCAGGGAGTGACATTGCAGG + Intronic
1110569088 13:76985270-76985292 GGACCAAGGAGCCAACTTGAAGG + Intergenic
1113961439 13:114128476-114128498 GGGCCAGGGAGGCACAGTCCAGG + Intronic
1117097034 14:52309563-52309585 GGGCAAAGGAGAGACAGTGCTGG - Intergenic
1118147639 14:63157546-63157568 GGGGCAAGGTCCCACATAGCTGG + Intergenic
1120234870 14:81878650-81878672 GGGCCATGAATCCAAATTGCTGG + Intergenic
1120497592 14:85256008-85256030 GGGACATGGAGGCACACTGCGGG + Intergenic
1121016557 14:90552656-90552678 GTCCCCAGGAGCCACACTGCAGG - Intronic
1121173552 14:91873754-91873776 GGGCCAAGAAGACACACAGCTGG - Intronic
1122479737 14:102039288-102039310 CGGCCAAGGAGCTACTGTGCGGG - Intronic
1122479747 14:102039328-102039350 TGGCCAAGGAGCTACTGTGCAGG - Intronic
1122628991 14:103098936-103098958 GGGCCCAGCAGGCACCTTGCTGG + Intergenic
1122952144 14:105050928-105050950 GTGCACAGGAACCACATTGCTGG + Exonic
1123714111 15:23013948-23013970 GGGCCCAGGCTCCACATAGCTGG - Intronic
1124360078 15:29030112-29030134 GGGTGATGGAGCAACATTGCTGG - Intronic
1126349443 15:47729432-47729454 GGGCCAAGGGACCACTTTGGAGG + Intronic
1130786585 15:87104305-87104327 GACCTAAGCAGCCACATTGCAGG + Intergenic
1132496777 16:267020-267042 GGGCCAAGGGGTGCCATTGCTGG + Intronic
1132882070 16:2166874-2166896 GGGCCAGGGACCCTCATTCCGGG + Intronic
1134093852 16:11405921-11405943 TGGCCAAGGAGCCACTGGGCTGG - Intronic
1139653043 16:68372115-68372137 GGGCCCAGGACACACAGTGCAGG + Exonic
1140214791 16:72998591-72998613 GGGCGAACCAGCCACATTTCGGG + Intronic
1141842665 16:86584102-86584124 GTGGAAAGGAGCCACAGTGCTGG + Intergenic
1142314431 16:89334670-89334692 GGGCCCAGGAGCAACATCCCAGG + Intronic
1143905931 17:10209193-10209215 GGGCAAAGGAGCCACAAGGAGGG - Intergenic
1144672449 17:17140609-17140631 GTGCCCAGGAGCCAGACTGCTGG + Intronic
1145203657 17:20969041-20969063 GGGCCAAGGAGACACAGAGAAGG + Intergenic
1145741795 17:27281025-27281047 GGGCCAGGGAGACAGAGTGCTGG + Intergenic
1146064307 17:29622774-29622796 GGGCGAAGGAGCCACCTCTCCGG + Exonic
1146412219 17:32596314-32596336 GGGCAGAGGAGCCTCACTGCAGG + Intronic
1146810990 17:35903100-35903122 AGGCCAAGGTGCCACATTTTGGG - Intergenic
1148062860 17:44848590-44848612 GGGCCCTTGAGCCACACTGCTGG - Intronic
1149655667 17:58308541-58308563 GAGCCAAGGAGCCACTCTCCCGG - Exonic
1153975550 18:10265556-10265578 TGGCCAAGGATGCACATTGTGGG - Intergenic
1160004999 18:75063184-75063206 GGGACAAGGAGCCACCTTCGTGG + Exonic
1160954236 19:1682812-1682834 GGGCCAAGGAGCCAAAATACGGG - Intergenic
1161013530 19:1971350-1971372 GGGCCACGAAGCCTCACTGCCGG + Intronic
1161816176 19:6501489-6501511 GGGCGAAGGAGGCACCTTCCAGG - Intronic
1163155603 19:15438534-15438556 AGGCCCAGGAGACACATGGCTGG - Intronic
1163637011 19:18441646-18441668 GGGCCAAGGAATCCCAATGCTGG + Intergenic
1165741971 19:38210121-38210143 GTGAGAGGGAGCCACATTGCGGG - Intergenic
1168345835 19:55649846-55649868 GGGCCAAGGAAGCAGATGGCAGG - Intronic
925027829 2:623540-623562 GGGGCCAGGAGCAACACTGCAGG + Intergenic
925833381 2:7918245-7918267 GGCATCAGGAGCCACATTGCAGG + Intergenic
925874503 2:8300489-8300511 AGGCCAAGGAGCCAACGTGCAGG + Intergenic
930503753 2:52255970-52255992 TGGCCCAGGAGCCCCATTGCAGG - Intergenic
933089624 2:78104453-78104475 GGGCCAAGCAGGGGCATTGCTGG + Intergenic
934527004 2:95058262-95058284 GGGCCCGGGAGCCACTCTGCTGG - Intergenic
935170794 2:100610310-100610332 GGGACAGGGAGCCACAGGGCGGG + Intergenic
937958707 2:127438425-127438447 GGGCCATGGAGCCAGGTGGCGGG + Intronic
938114255 2:128592474-128592496 GGGCCAAGAAGCCAGAGAGCAGG + Intergenic
940022673 2:149171913-149171935 GGGCCTGGGAGCCACAAAGCAGG - Intronic
940412849 2:153386556-153386578 GGGCCAGAGAGCAACATTCCAGG + Intergenic
940954525 2:159712812-159712834 GGGCCAAGGGGCCACAGCGCAGG + Intronic
942110261 2:172674861-172674883 CGTCCAAGGCGCCACCTTGCGGG + Intergenic
944200813 2:197105552-197105574 GGGCTGAGGAGACACATTGGTGG + Intronic
945619702 2:212119656-212119678 CTACCAAGGAACCACATTGCTGG - Intronic
948483766 2:238267246-238267268 GGACCAAGGTGCCACAAAGCAGG + Intronic
1168806405 20:674823-674845 GGGACCAGGAGCCACTTTGGGGG + Intronic
1173084060 20:39898406-39898428 GAGCCAAGGAGCCTCATGGGTGG - Intergenic
1173549295 20:43921263-43921285 GGGGCAAGGAGCCACACAGCAGG - Intronic
1173731249 20:45330261-45330283 GCACCAAGGAGCCTCATGGCTGG + Intronic
1177807078 21:25885069-25885091 GGGCCAAGCTGCCCCATGGCAGG - Intronic
1179302717 21:40126984-40127006 GGGCCCTGGAGCCTCACTGCTGG + Intronic
1180564480 22:16651184-16651206 GGCCAAAGGGGCCACACTGCAGG - Intergenic
1180758063 22:18177034-18177056 GGACCGAGCAGCCACATGGCCGG - Exonic
1180768351 22:18360826-18360848 GGACCGAGCAGCCACATGGCCGG - Intergenic
1180777958 22:18501565-18501587 GGACCGAGCAGCCACATGGCCGG + Intergenic
1180810682 22:18758876-18758898 GGACCGAGCAGCCACATGGCCGG + Intergenic
1180826228 22:18864050-18864072 GGACCGAGCAGCCACATGGCCGG - Intergenic
1180967819 22:19799694-19799716 CAGCCAAGGAGTCACAGTGCAGG + Intronic
1180999658 22:19982094-19982116 GGGGCAAGGAGGGACATTGGTGG + Intronic
1181196830 22:21193131-21193153 GGACCGAGCAGCCACATGGCCGG + Intergenic
1181212698 22:21299993-21300015 GGACCGAGCAGCCACATGGCCGG - Intergenic
1182023046 22:27097301-27097323 GGAGCAAAGAGACACATTGCGGG + Intergenic
1182070728 22:27461936-27461958 GGGAGAAGGAGACACATTGAAGG + Intergenic
1183347055 22:37313705-37313727 AGGCCAGGGGGCCTCATTGCTGG - Exonic
1183615014 22:38938740-38938762 GGGGACAGGAGCCAGATTGCAGG + Intergenic
1184105133 22:42363010-42363032 GGGCCCAGGAGGCAGGTTGCTGG - Intergenic
1203229970 22_KI270731v1_random:101714-101736 GGACCGAGCAGCCACATGGCCGG - Intergenic
1203276370 22_KI270734v1_random:89956-89978 GGACCGAGCAGCCACATGGCCGG - Intergenic
949152063 3:781302-781324 AGGCCAAGGAGCCACATTCTGGG - Intergenic
951708588 3:25567954-25567976 GGGCAAAGGAGACACAATGAGGG - Intronic
953386085 3:42506326-42506348 GGCCAAAGGAGCCACAGTGAAGG - Intronic
954675704 3:52314297-52314319 GGGCCAAAGCGCCAGATGGCAGG - Intergenic
954681833 3:52350132-52350154 GGGCCAGGGAGGCACAGGGCTGG + Intronic
956771360 3:72528717-72528739 GTACCAAGGAGCCCAATTGCTGG - Intergenic
957086530 3:75684515-75684537 GAGCCATAGAGCCACATTCCAGG - Intergenic
960996387 3:123343274-123343296 GGGACCACCAGCCACATTGCAGG - Intronic
961335927 3:126179846-126179868 GGCCCCAGGAGCCACGTTGTGGG + Intronic
962289732 3:134123887-134123909 GGCCCAAGGTGCCACCTTGAGGG - Intronic
965118683 3:164522395-164522417 GGGCCAAGGTGGTACAGTGCTGG + Intergenic
967292824 3:187937848-187937870 GGGGCAAGGATTCAAATTGCTGG + Intergenic
967807759 3:193730603-193730625 GGGCCAGGGAGCCCCATGCCAGG - Intergenic
969471714 4:7392973-7392995 GGGCCAGGGAGCCAGGGTGCTGG - Intronic
972765484 4:42150054-42150076 GGGAAAAGGACCCAAATTGCTGG + Intronic
977587939 4:98795487-98795509 AGGCAAAGGAGACAAATTGCCGG + Intergenic
982206957 4:153004057-153004079 GGCACAAAGAGCCACATTGAAGG - Intergenic
984882825 4:184425482-184425504 GGGCCTCGGGGCCACAGTGCAGG + Intronic
985889450 5:2704449-2704471 GCTCCACGGAGCCACATGGCAGG + Intergenic
991029179 5:62065003-62065025 GGGCCAAGTAGCCACATGCCAGG + Intergenic
991386221 5:66093176-66093198 CAGCCAAGAAGCCACATTGGAGG + Intergenic
991657625 5:68920020-68920042 GGGCCAAGCAGCCATCTTGCAGG + Intergenic
993787033 5:92154185-92154207 GGGCCGAGGAGTGAAATTGCTGG + Intergenic
996431415 5:123382554-123382576 CTGCCAAGGTGCCACATTTCAGG + Intronic
996962766 5:129270996-129271018 GAACCAAGGAGCATCATTGCTGG - Intergenic
998385504 5:141754936-141754958 GGAACAAGGAGCCAGATTTCAGG + Intergenic
999115625 5:149160974-149160996 GGGCTAAGAAGCCCCATGGCTGG - Intronic
1000047427 5:157533209-157533231 GGGCAGAGGAGCCACATCGCTGG - Intronic
1001982358 5:176045961-176045983 GGGCCAAGAAGTCACTTTCCTGG + Intergenic
1002067426 5:176658949-176658971 GGGCCAAGGAGCCACATTGCTGG - Exonic
1002129801 5:177073646-177073668 GGTCAAAGGAGCCAGGTTGCTGG + Intronic
1002235103 5:177798096-177798118 GGGCCAAGAAGTCACTTTCCTGG - Intergenic
1005635837 6:27752411-27752433 GGGCGATGGAGAGACATTGCTGG - Intergenic
1013374269 6:109498928-109498950 GGGACTAGGAGCCCCATTACTGG - Intronic
1014217718 6:118768552-118768574 GGGCCAGGCAGTCAGATTGCTGG - Intergenic
1018820509 6:167370213-167370235 GGGCCCGGCAGCCACCTTGCAGG - Intronic
1019437335 7:1028798-1028820 GGGCCATGGAGTCAGATTGGGGG - Intronic
1020732670 7:11903262-11903284 GTGCCAAGGATCCACATTGAGGG + Intergenic
1023859215 7:44207280-44207302 AGGCCAAGGAGCCTCATTCAGGG + Intronic
1023873797 7:44276264-44276286 AGGACAAGGCGCCGCATTGCAGG - Intronic
1024899612 7:54303735-54303757 GTGCCAAGGAGCATGATTGCTGG - Intergenic
1026521314 7:71120583-71120605 GGGCCAAGGAGCAAGATAGCAGG + Intergenic
1027167770 7:75847764-75847786 GTGCCAAGGAGCCACACTGGCGG + Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1043522973 8:81066056-81066078 GGGCCAGGGAGCAAAATTACAGG + Intronic
1043965538 8:86470525-86470547 GGACCCAGGAGCCACACTCCTGG + Intronic
1048045307 8:130767300-130767322 GGGCAAAGGAACCACATGTCTGG - Intergenic
1049599959 8:143503154-143503176 GCCCCAAGCAGCCACATGGCCGG + Intronic
1049604768 8:143524168-143524190 GGGCCCTGGAGCAACATGGCCGG + Intronic
1050127005 9:2367785-2367807 GGGCCTAGGCTCCACACTGCTGG - Intergenic
1050752976 9:8962905-8962927 GTTCCTAAGAGCCACATTGCCGG - Intronic
1056789184 9:89614786-89614808 GGGCCTAGGGGCCACATAGAAGG - Intergenic
1056793140 9:89639185-89639207 GGCCCCAGGAGCCACACTGCGGG - Intergenic
1057699079 9:97349896-97349918 GGGTGCAGGAGCCACCTTGCTGG + Intronic
1057913923 9:99041132-99041154 GGGCCAAATAGGCACATTCCAGG + Intronic
1060344433 9:122803969-122803991 GGTCCAGGGAGCCACATGCCTGG - Intronic
1060375001 9:123109623-123109645 GTGCGAAGGAGCCACAGTGCGGG + Intronic
1060722313 9:125987281-125987303 GGGGCAGGGAGCAACACTGCTGG - Intergenic
1060821027 9:126661685-126661707 GGGCCCCGCAGCCACACTGCAGG - Intronic
1061283226 9:129609226-129609248 GGGCTAAGGAGCCAGCTTGCAGG + Intronic
1061504607 9:131024863-131024885 TAGCTAAGGAGTCACATTGCAGG + Intronic
1062023941 9:134331930-134331952 GTTCCCAGGAGCCCCATTGCTGG + Intronic
1062677716 9:137757422-137757444 GGCCCAAGGTGCCATGTTGCAGG - Intronic
1188086665 X:25907430-25907452 GGACCAAGGAGTCACATTTTTGG + Intergenic
1196373197 X:115001510-115001532 GGGCCAAGCAGCCAACTTGGAGG + Intergenic
1200072813 X:153537401-153537423 GTGCCAAGGAGCCTCACGGCTGG - Intronic