ID: 1002067731

View in Genome Browser
Species Human (GRCh38)
Location 5:176660603-176660625
Sequence GGCCCAGGGACCCTCCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002067731_1002067740 11 Left 1002067731 5:176660603-176660625 CCCTCTAGGAGGGTCCCTGGGCC No data
Right 1002067740 5:176660637-176660659 GTCACCTCCCACCGTCTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002067731 Original CRISPR GGCCCAGGGACCCTCCTAGA GGG (reversed) Intergenic
No off target data available for this crispr