ID: 1002068135

View in Genome Browser
Species Human (GRCh38)
Location 5:176662727-176662749
Sequence AACAGCCTTGGCAGGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002068135_1002068154 28 Left 1002068135 5:176662727-176662749 CCCCCAGCCCTGCCAAGGCTGTT No data
Right 1002068154 5:176662778-176662800 GGCAGCTATGTGGAGAGATAGGG No data
1002068135_1002068148 18 Left 1002068135 5:176662727-176662749 CCCCCAGCCCTGCCAAGGCTGTT No data
Right 1002068148 5:176662768-176662790 TGGCCCCCTTGGCAGCTATGTGG No data
1002068135_1002068142 -2 Left 1002068135 5:176662727-176662749 CCCCCAGCCCTGCCAAGGCTGTT No data
Right 1002068142 5:176662748-176662770 TTGCCACAGTAATGCCTCCCTGG No data
1002068135_1002068144 7 Left 1002068135 5:176662727-176662749 CCCCCAGCCCTGCCAAGGCTGTT No data
Right 1002068144 5:176662757-176662779 TAATGCCTCCCTGGCCCCCTTGG No data
1002068135_1002068153 27 Left 1002068135 5:176662727-176662749 CCCCCAGCCCTGCCAAGGCTGTT No data
Right 1002068153 5:176662777-176662799 TGGCAGCTATGTGGAGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002068135 Original CRISPR AACAGCCTTGGCAGGGCTGG GGG (reversed) Intergenic
No off target data available for this crispr