ID: 1002069222

View in Genome Browser
Species Human (GRCh38)
Location 5:176669153-176669175
Sequence CAACAAAAAGTACAAAAATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002069222_1002069226 -1 Left 1002069222 5:176669153-176669175 CCGCATTTTTGTACTTTTTGTTG No data
Right 1002069226 5:176669175-176669197 GGGGATTTCGCTGTTGAAAATGG No data
1002069222_1002069227 20 Left 1002069222 5:176669153-176669175 CCGCATTTTTGTACTTTTTGTTG No data
Right 1002069227 5:176669196-176669218 GGCCCTCAAGCATCAGAGTGAGG No data
1002069222_1002069231 30 Left 1002069222 5:176669153-176669175 CCGCATTTTTGTACTTTTTGTTG No data
Right 1002069231 5:176669206-176669228 CATCAGAGTGAGGCCCTGGCTGG No data
1002069222_1002069230 26 Left 1002069222 5:176669153-176669175 CCGCATTTTTGTACTTTTTGTTG No data
Right 1002069230 5:176669202-176669224 CAAGCATCAGAGTGAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002069222 Original CRISPR CAACAAAAAGTACAAAAATG CGG (reversed) Intergenic
No off target data available for this crispr