ID: 1002069231

View in Genome Browser
Species Human (GRCh38)
Location 5:176669206-176669228
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002069222_1002069231 30 Left 1002069222 5:176669153-176669175 CCGCATTTTTGTACTTTTTGTTG No data
Right 1002069231 5:176669206-176669228 CATCAGAGTGAGGCCCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002069231 Original CRISPR CATCAGAGTGAGGCCCTGGC TGG Intergenic
No off target data available for this crispr