ID: 1002069790

View in Genome Browser
Species Human (GRCh38)
Location 5:176672338-176672360
Sequence TGTCCTCTGCAGGACCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002069790_1002069794 -6 Left 1002069790 5:176672338-176672360 CCCTGCAGGTCCTGCAGAGGACA No data
Right 1002069794 5:176672355-176672377 AGGACACCCCAAGGTTACCTTGG No data
1002069790_1002069801 16 Left 1002069790 5:176672338-176672360 CCCTGCAGGTCCTGCAGAGGACA No data
Right 1002069801 5:176672377-176672399 GCCTGTGGCTCCGCGGCTCAAGG No data
1002069790_1002069797 1 Left 1002069790 5:176672338-176672360 CCCTGCAGGTCCTGCAGAGGACA No data
Right 1002069797 5:176672362-176672384 CCCAAGGTTACCTTGGCCTGTGG No data
1002069790_1002069803 23 Left 1002069790 5:176672338-176672360 CCCTGCAGGTCCTGCAGAGGACA No data
Right 1002069803 5:176672384-176672406 GCTCCGCGGCTCAAGGCTGCTGG No data
1002069790_1002069799 9 Left 1002069790 5:176672338-176672360 CCCTGCAGGTCCTGCAGAGGACA No data
Right 1002069799 5:176672370-176672392 TACCTTGGCCTGTGGCTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002069790 Original CRISPR TGTCCTCTGCAGGACCTGCA GGG (reversed) Intergenic
No off target data available for this crispr