ID: 1002070382

View in Genome Browser
Species Human (GRCh38)
Location 5:176675915-176675937
Sequence AAAAAGCGACTCCTCCCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002070382_1002070387 2 Left 1002070382 5:176675915-176675937 CCTAGTGGGAGGAGTCGCTTTTT No data
Right 1002070387 5:176675940-176675962 GGAAACTTCAAAAGCAGGTGGGG No data
1002070382_1002070386 1 Left 1002070382 5:176675915-176675937 CCTAGTGGGAGGAGTCGCTTTTT No data
Right 1002070386 5:176675939-176675961 AGGAAACTTCAAAAGCAGGTGGG No data
1002070382_1002070384 -3 Left 1002070382 5:176675915-176675937 CCTAGTGGGAGGAGTCGCTTTTT No data
Right 1002070384 5:176675935-176675957 TTTGAGGAAACTTCAAAAGCAGG No data
1002070382_1002070389 12 Left 1002070382 5:176675915-176675937 CCTAGTGGGAGGAGTCGCTTTTT No data
Right 1002070389 5:176675950-176675972 AAAGCAGGTGGGGCTAGGTGAGG No data
1002070382_1002070385 0 Left 1002070382 5:176675915-176675937 CCTAGTGGGAGGAGTCGCTTTTT No data
Right 1002070385 5:176675938-176675960 GAGGAAACTTCAAAAGCAGGTGG No data
1002070382_1002070388 7 Left 1002070382 5:176675915-176675937 CCTAGTGGGAGGAGTCGCTTTTT No data
Right 1002070388 5:176675945-176675967 CTTCAAAAGCAGGTGGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002070382 Original CRISPR AAAAAGCGACTCCTCCCACT AGG (reversed) Intergenic
No off target data available for this crispr