ID: 1002070388

View in Genome Browser
Species Human (GRCh38)
Location 5:176675945-176675967
Sequence CTTCAAAAGCAGGTGGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002070382_1002070388 7 Left 1002070382 5:176675915-176675937 CCTAGTGGGAGGAGTCGCTTTTT No data
Right 1002070388 5:176675945-176675967 CTTCAAAAGCAGGTGGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002070388 Original CRISPR CTTCAAAAGCAGGTGGGGCT AGG Intergenic
No off target data available for this crispr