ID: 1002072385

View in Genome Browser
Species Human (GRCh38)
Location 5:176688001-176688023
Sequence TGGGATGACTAGCAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002072385_1002072391 16 Left 1002072385 5:176688001-176688023 CCTCTCTGCTGCTAGTCATCCCA No data
Right 1002072391 5:176688040-176688062 GGCTGAGCCCAGGGCTTTTATGG 0: 65
1: 121
2: 262
3: 300
4: 619
1002072385_1002072395 26 Left 1002072385 5:176688001-176688023 CCTCTCTGCTGCTAGTCATCCCA No data
Right 1002072395 5:176688050-176688072 AGGGCTTTTATGGGCCTCAGAGG 0: 31
1: 127
2: 173
3: 183
4: 279
1002072385_1002072390 7 Left 1002072385 5:176688001-176688023 CCTCTCTGCTGCTAGTCATCCCA No data
Right 1002072390 5:176688031-176688053 CTCAGCTCTGGCTGAGCCCAGGG No data
1002072385_1002072396 29 Left 1002072385 5:176688001-176688023 CCTCTCTGCTGCTAGTCATCCCA No data
Right 1002072396 5:176688053-176688075 GCTTTTATGGGCCTCAGAGGCGG No data
1002072385_1002072389 6 Left 1002072385 5:176688001-176688023 CCTCTCTGCTGCTAGTCATCCCA No data
Right 1002072389 5:176688030-176688052 GCTCAGCTCTGGCTGAGCCCAGG No data
1002072385_1002072392 17 Left 1002072385 5:176688001-176688023 CCTCTCTGCTGCTAGTCATCCCA No data
Right 1002072392 5:176688041-176688063 GCTGAGCCCAGGGCTTTTATGGG 0: 27
1: 73
2: 217
3: 301
4: 591
1002072385_1002072386 -5 Left 1002072385 5:176688001-176688023 CCTCTCTGCTGCTAGTCATCCCA No data
Right 1002072386 5:176688019-176688041 TCCCACTGTCTGCTCAGCTCTGG No data
1002072385_1002072397 30 Left 1002072385 5:176688001-176688023 CCTCTCTGCTGCTAGTCATCCCA No data
Right 1002072397 5:176688054-176688076 CTTTTATGGGCCTCAGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002072385 Original CRISPR TGGGATGACTAGCAGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr