ID: 1002072502

View in Genome Browser
Species Human (GRCh38)
Location 5:176688489-176688511
Sequence TTGTGGGGCCAGGAACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002072502_1002072510 8 Left 1002072502 5:176688489-176688511 CCTGTCTGTTCCTGGCCCCACAA No data
Right 1002072510 5:176688520-176688542 GGAGACTCGGATCCGCAGCCAGG No data
1002072502_1002072512 15 Left 1002072502 5:176688489-176688511 CCTGTCTGTTCCTGGCCCCACAA No data
Right 1002072512 5:176688527-176688549 CGGATCCGCAGCCAGGACTTGGG No data
1002072502_1002072513 18 Left 1002072502 5:176688489-176688511 CCTGTCTGTTCCTGGCCCCACAA No data
Right 1002072513 5:176688530-176688552 ATCCGCAGCCAGGACTTGGGTGG No data
1002072502_1002072511 14 Left 1002072502 5:176688489-176688511 CCTGTCTGTTCCTGGCCCCACAA No data
Right 1002072511 5:176688526-176688548 TCGGATCCGCAGCCAGGACTTGG No data
1002072502_1002072509 -5 Left 1002072502 5:176688489-176688511 CCTGTCTGTTCCTGGCCCCACAA No data
Right 1002072509 5:176688507-176688529 CACAAGAGCACAGGGAGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002072502 Original CRISPR TTGTGGGGCCAGGAACAGAC AGG (reversed) Intergenic