ID: 1002072504

View in Genome Browser
Species Human (GRCh38)
Location 5:176688499-176688521
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002072504_1002072513 8 Left 1002072504 5:176688499-176688521 CCTGGCCCCACAAGAGCACAGGG No data
Right 1002072513 5:176688530-176688552 ATCCGCAGCCAGGACTTGGGTGG No data
1002072504_1002072516 24 Left 1002072504 5:176688499-176688521 CCTGGCCCCACAAGAGCACAGGG No data
Right 1002072516 5:176688546-176688568 TGGGTGGCTGCAATGTCACCTGG No data
1002072504_1002072517 25 Left 1002072504 5:176688499-176688521 CCTGGCCCCACAAGAGCACAGGG No data
Right 1002072517 5:176688547-176688569 GGGTGGCTGCAATGTCACCTGGG No data
1002072504_1002072518 26 Left 1002072504 5:176688499-176688521 CCTGGCCCCACAAGAGCACAGGG No data
Right 1002072518 5:176688548-176688570 GGTGGCTGCAATGTCACCTGGGG No data
1002072504_1002072512 5 Left 1002072504 5:176688499-176688521 CCTGGCCCCACAAGAGCACAGGG No data
Right 1002072512 5:176688527-176688549 CGGATCCGCAGCCAGGACTTGGG No data
1002072504_1002072511 4 Left 1002072504 5:176688499-176688521 CCTGGCCCCACAAGAGCACAGGG No data
Right 1002072511 5:176688526-176688548 TCGGATCCGCAGCCAGGACTTGG No data
1002072504_1002072510 -2 Left 1002072504 5:176688499-176688521 CCTGGCCCCACAAGAGCACAGGG No data
Right 1002072510 5:176688520-176688542 GGAGACTCGGATCCGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002072504 Original CRISPR CCCTGTGCTCTTGTGGGGCC AGG (reversed) Intergenic
No off target data available for this crispr