ID: 1002072510

View in Genome Browser
Species Human (GRCh38)
Location 5:176688520-176688542
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002072507_1002072510 -8 Left 1002072507 5:176688505-176688527 CCCACAAGAGCACAGGGAGACTC No data
Right 1002072510 5:176688520-176688542 GGAGACTCGGATCCGCAGCCAGG No data
1002072508_1002072510 -9 Left 1002072508 5:176688506-176688528 CCACAAGAGCACAGGGAGACTCG No data
Right 1002072510 5:176688520-176688542 GGAGACTCGGATCCGCAGCCAGG No data
1002072504_1002072510 -2 Left 1002072504 5:176688499-176688521 CCTGGCCCCACAAGAGCACAGGG No data
Right 1002072510 5:176688520-176688542 GGAGACTCGGATCCGCAGCCAGG No data
1002072502_1002072510 8 Left 1002072502 5:176688489-176688511 CCTGTCTGTTCCTGGCCCCACAA No data
Right 1002072510 5:176688520-176688542 GGAGACTCGGATCCGCAGCCAGG No data
1002072499_1002072510 25 Left 1002072499 5:176688472-176688494 CCCAGGAGGGCAGGGTTCCTGTC No data
Right 1002072510 5:176688520-176688542 GGAGACTCGGATCCGCAGCCAGG No data
1002072500_1002072510 24 Left 1002072500 5:176688473-176688495 CCAGGAGGGCAGGGTTCCTGTCT No data
Right 1002072510 5:176688520-176688542 GGAGACTCGGATCCGCAGCCAGG No data
1002072506_1002072510 -7 Left 1002072506 5:176688504-176688526 CCCCACAAGAGCACAGGGAGACT No data
Right 1002072510 5:176688520-176688542 GGAGACTCGGATCCGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002072510 Original CRISPR GGAGACTCGGATCCGCAGCC AGG Intergenic