ID: 1002072512

View in Genome Browser
Species Human (GRCh38)
Location 5:176688527-176688549
Sequence CGGATCCGCAGCCAGGACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002072506_1002072512 0 Left 1002072506 5:176688504-176688526 CCCCACAAGAGCACAGGGAGACT No data
Right 1002072512 5:176688527-176688549 CGGATCCGCAGCCAGGACTTGGG No data
1002072508_1002072512 -2 Left 1002072508 5:176688506-176688528 CCACAAGAGCACAGGGAGACTCG No data
Right 1002072512 5:176688527-176688549 CGGATCCGCAGCCAGGACTTGGG No data
1002072504_1002072512 5 Left 1002072504 5:176688499-176688521 CCTGGCCCCACAAGAGCACAGGG No data
Right 1002072512 5:176688527-176688549 CGGATCCGCAGCCAGGACTTGGG No data
1002072502_1002072512 15 Left 1002072502 5:176688489-176688511 CCTGTCTGTTCCTGGCCCCACAA No data
Right 1002072512 5:176688527-176688549 CGGATCCGCAGCCAGGACTTGGG No data
1002072507_1002072512 -1 Left 1002072507 5:176688505-176688527 CCCACAAGAGCACAGGGAGACTC No data
Right 1002072512 5:176688527-176688549 CGGATCCGCAGCCAGGACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002072512 Original CRISPR CGGATCCGCAGCCAGGACTT GGG Intergenic