ID: 1002072514

View in Genome Browser
Species Human (GRCh38)
Location 5:176688532-176688554
Sequence AGCCACCCAAGTCCTGGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002072514_1002072517 -8 Left 1002072514 5:176688532-176688554 CCGCAGCCAGGACTTGGGTGGCT No data
Right 1002072517 5:176688547-176688569 GGGTGGCTGCAATGTCACCTGGG No data
1002072514_1002072520 12 Left 1002072514 5:176688532-176688554 CCGCAGCCAGGACTTGGGTGGCT No data
Right 1002072520 5:176688567-176688589 GGGGAGCTCCTACCCCAGCTTGG No data
1002072514_1002072522 18 Left 1002072514 5:176688532-176688554 CCGCAGCCAGGACTTGGGTGGCT No data
Right 1002072522 5:176688573-176688595 CTCCTACCCCAGCTTGGAAAGGG No data
1002072514_1002072524 21 Left 1002072514 5:176688532-176688554 CCGCAGCCAGGACTTGGGTGGCT No data
Right 1002072524 5:176688576-176688598 CTACCCCAGCTTGGAAAGGGTGG No data
1002072514_1002072516 -9 Left 1002072514 5:176688532-176688554 CCGCAGCCAGGACTTGGGTGGCT No data
Right 1002072516 5:176688546-176688568 TGGGTGGCTGCAATGTCACCTGG No data
1002072514_1002072521 17 Left 1002072514 5:176688532-176688554 CCGCAGCCAGGACTTGGGTGGCT No data
Right 1002072521 5:176688572-176688594 GCTCCTACCCCAGCTTGGAAAGG No data
1002072514_1002072525 22 Left 1002072514 5:176688532-176688554 CCGCAGCCAGGACTTGGGTGGCT No data
Right 1002072525 5:176688577-176688599 TACCCCAGCTTGGAAAGGGTGGG No data
1002072514_1002072518 -7 Left 1002072514 5:176688532-176688554 CCGCAGCCAGGACTTGGGTGGCT No data
Right 1002072518 5:176688548-176688570 GGTGGCTGCAATGTCACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002072514 Original CRISPR AGCCACCCAAGTCCTGGCTG CGG (reversed) Intergenic
No off target data available for this crispr