ID: 1002072518

View in Genome Browser
Species Human (GRCh38)
Location 5:176688548-176688570
Sequence GGTGGCTGCAATGTCACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002072507_1002072518 20 Left 1002072507 5:176688505-176688527 CCCACAAGAGCACAGGGAGACTC No data
Right 1002072518 5:176688548-176688570 GGTGGCTGCAATGTCACCTGGGG No data
1002072508_1002072518 19 Left 1002072508 5:176688506-176688528 CCACAAGAGCACAGGGAGACTCG No data
Right 1002072518 5:176688548-176688570 GGTGGCTGCAATGTCACCTGGGG No data
1002072514_1002072518 -7 Left 1002072514 5:176688532-176688554 CCGCAGCCAGGACTTGGGTGGCT No data
Right 1002072518 5:176688548-176688570 GGTGGCTGCAATGTCACCTGGGG No data
1002072504_1002072518 26 Left 1002072504 5:176688499-176688521 CCTGGCCCCACAAGAGCACAGGG No data
Right 1002072518 5:176688548-176688570 GGTGGCTGCAATGTCACCTGGGG No data
1002072506_1002072518 21 Left 1002072506 5:176688504-176688526 CCCCACAAGAGCACAGGGAGACT No data
Right 1002072518 5:176688548-176688570 GGTGGCTGCAATGTCACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002072518 Original CRISPR GGTGGCTGCAATGTCACCTG GGG Intergenic
No off target data available for this crispr