ID: 1002073445

View in Genome Browser
Species Human (GRCh38)
Location 5:176694363-176694385
Sequence GGGGACTCCCAGAGAGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002073436_1002073445 30 Left 1002073436 5:176694310-176694332 CCTGGGGCGAGGTCTGCTACATC No data
Right 1002073445 5:176694363-176694385 GGGGACTCCCAGAGAGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002073445 Original CRISPR GGGGACTCCCAGAGAGAAAC TGG Intergenic
No off target data available for this crispr