ID: 1002075311

View in Genome Browser
Species Human (GRCh38)
Location 5:176705042-176705064
Sequence GTGGCTTCTCTAGGAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002075311_1002075317 -6 Left 1002075311 5:176705042-176705064 CCTGTGTTTCCTAGAGAAGCCAC No data
Right 1002075317 5:176705059-176705081 AGCCACTCCGGTGGGGTCCGAGG No data
1002075311_1002075322 22 Left 1002075311 5:176705042-176705064 CCTGTGTTTCCTAGAGAAGCCAC No data
Right 1002075322 5:176705087-176705109 TCAGCTCTCAGCACAGCCTCGGG No data
1002075311_1002075321 21 Left 1002075311 5:176705042-176705064 CCTGTGTTTCCTAGAGAAGCCAC No data
Right 1002075321 5:176705086-176705108 CTCAGCTCTCAGCACAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002075311 Original CRISPR GTGGCTTCTCTAGGAAACAC AGG (reversed) Intergenic
No off target data available for this crispr