ID: 1002079458

View in Genome Browser
Species Human (GRCh38)
Location 5:176728735-176728757
Sequence CTGTCGGGATGGAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002079452_1002079458 26 Left 1002079452 5:176728686-176728708 CCTCAGTTTAATAGGCCTCAGAT 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG No data
1002079454_1002079458 11 Left 1002079454 5:176728701-176728723 CCTCAGATTTGCACTGGAGACTC 0: 1
1: 0
2: 3
3: 7
4: 161
Right 1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002079458 Original CRISPR CTGTCGGGATGGAGAGAAGA AGG Intergenic
No off target data available for this crispr