ID: 1002079590

View in Genome Browser
Species Human (GRCh38)
Location 5:176729426-176729448
Sequence GACCCAAAACATGGTTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002079582_1002079590 27 Left 1002079582 5:176729376-176729398 CCGCAGTTTCTGTAACCCTATGG No data
Right 1002079590 5:176729426-176729448 GACCCAAAACATGGTTTTACTGG No data
1002079581_1002079590 28 Left 1002079581 5:176729375-176729397 CCCGCAGTTTCTGTAACCCTATG No data
Right 1002079590 5:176729426-176729448 GACCCAAAACATGGTTTTACTGG No data
1002079587_1002079590 12 Left 1002079587 5:176729391-176729413 CCCTATGGGGAATTTCTGGCATT No data
Right 1002079590 5:176729426-176729448 GACCCAAAACATGGTTTTACTGG No data
1002079588_1002079590 11 Left 1002079588 5:176729392-176729414 CCTATGGGGAATTTCTGGCATTT No data
Right 1002079590 5:176729426-176729448 GACCCAAAACATGGTTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002079590 Original CRISPR GACCCAAAACATGGTTTTAC TGG Intergenic
No off target data available for this crispr