ID: 1002080977

View in Genome Browser
Species Human (GRCh38)
Location 5:176737260-176737282
Sequence GATCCATTTGAGCAGTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002080974_1002080977 0 Left 1002080974 5:176737237-176737259 CCCTGGCTGTTCTCGTTGATGTA No data
Right 1002080977 5:176737260-176737282 GATCCATTTGAGCAGTTTCAGGG No data
1002080975_1002080977 -1 Left 1002080975 5:176737238-176737260 CCTGGCTGTTCTCGTTGATGTAG No data
Right 1002080977 5:176737260-176737282 GATCCATTTGAGCAGTTTCAGGG No data
1002080973_1002080977 1 Left 1002080973 5:176737236-176737258 CCCCTGGCTGTTCTCGTTGATGT No data
Right 1002080977 5:176737260-176737282 GATCCATTTGAGCAGTTTCAGGG No data
1002080972_1002080977 4 Left 1002080972 5:176737233-176737255 CCTCCCCTGGCTGTTCTCGTTGA No data
Right 1002080977 5:176737260-176737282 GATCCATTTGAGCAGTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002080977 Original CRISPR GATCCATTTGAGCAGTTTCA GGG Intergenic
No off target data available for this crispr