ID: 1002081191

View in Genome Browser
Species Human (GRCh38)
Location 5:176738452-176738474
Sequence TCCCCATGGTGAGGGTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002081180_1002081191 15 Left 1002081180 5:176738414-176738436 CCTGGTCTCCATCTGCTTGCCAG No data
Right 1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG No data
1002081183_1002081191 -8 Left 1002081183 5:176738437-176738459 CCTTAGTTTCCCACCTCCCCATG No data
Right 1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG No data
1002081182_1002081191 -4 Left 1002081182 5:176738433-176738455 CCAGCCTTAGTTTCCCACCTCCC No data
Right 1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG No data
1002081179_1002081191 16 Left 1002081179 5:176738413-176738435 CCCTGGTCTCCATCTGCTTGCCA No data
Right 1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG No data
1002081181_1002081191 7 Left 1002081181 5:176738422-176738444 CCATCTGCTTGCCAGCCTTAGTT No data
Right 1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002081191 Original CRISPR TCCCCATGGTGAGGGTGTGA GGG Intergenic
No off target data available for this crispr