ID: 1002082203

View in Genome Browser
Species Human (GRCh38)
Location 5:176743689-176743711
Sequence CCTGTTTACCAGCACGACAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002082198_1002082203 -8 Left 1002082198 5:176743674-176743696 CCCCTTTCCAGGAGGCCTGTTTA 0: 1
1: 0
2: 3
3: 11
4: 180
Right 1002082203 5:176743689-176743711 CCTGTTTACCAGCACGACAACGG 0: 1
1: 0
2: 0
3: 5
4: 77
1002082191_1002082203 27 Left 1002082191 5:176743639-176743661 CCGCTGTCCGCCTTGGGTACAGA 0: 1
1: 0
2: 1
3: 6
4: 100
Right 1002082203 5:176743689-176743711 CCTGTTTACCAGCACGACAACGG 0: 1
1: 0
2: 0
3: 5
4: 77
1002082200_1002082203 -10 Left 1002082200 5:176743676-176743698 CCTTTCCAGGAGGCCTGTTTACC 0: 1
1: 0
2: 0
3: 16
4: 131
Right 1002082203 5:176743689-176743711 CCTGTTTACCAGCACGACAACGG 0: 1
1: 0
2: 0
3: 5
4: 77
1002082199_1002082203 -9 Left 1002082199 5:176743675-176743697 CCCTTTCCAGGAGGCCTGTTTAC 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1002082203 5:176743689-176743711 CCTGTTTACCAGCACGACAACGG 0: 1
1: 0
2: 0
3: 5
4: 77
1002082193_1002082203 20 Left 1002082193 5:176743646-176743668 CCGCCTTGGGTACAGAAGCGGCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1002082203 5:176743689-176743711 CCTGTTTACCAGCACGACAACGG 0: 1
1: 0
2: 0
3: 5
4: 77
1002082194_1002082203 17 Left 1002082194 5:176743649-176743671 CCTTGGGTACAGAAGCGGCGAGT 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1002082203 5:176743689-176743711 CCTGTTTACCAGCACGACAACGG 0: 1
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002082203 Original CRISPR CCTGTTTACCAGCACGACAA CGG Intergenic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
902601846 1:17545262-17545284 CCTGTTTACCAGCACACCACTGG + Intronic
902649960 1:17830644-17830666 CCTTTTTACCACCACCACTATGG - Intergenic
903907890 1:26698140-26698162 GCTGTTTACCAGCACTTCCAGGG - Intronic
906533134 1:46535000-46535022 TCTGTCAACCAGCACCACAAGGG - Intergenic
907773017 1:57484863-57484885 CTTGTTCACCAGCACCACACAGG - Intronic
908118885 1:60967053-60967075 CCTTTTTAGCAGCACGAGAATGG - Intronic
908260791 1:62338136-62338158 CCTGTGGCCCAGCACGAAAAGGG - Intergenic
909879645 1:80858239-80858261 ACTGATAACCAGCAAGACAATGG + Intergenic
909946034 1:81663782-81663804 CATGTTTAGCAGCATGATAATGG + Intronic
910359652 1:86403089-86403111 CATTATTACCAGCAGGACAAAGG + Intergenic
912285874 1:108368565-108368587 CCTGTCTACCATCACAAAAATGG + Intergenic
919560600 1:199114078-199114100 GCTGCTTACCAGCATGCCAAGGG + Intergenic
921119555 1:212124974-212124996 CCTGTAGACCAGGACGACAATGG + Intergenic
1065148392 10:22796689-22796711 CCTTTTTGCCACCACTACAATGG - Intergenic
1065899083 10:30188764-30188786 CACGTTTACCAGCACGTCACTGG + Intergenic
1068848481 10:61707992-61708014 CTTGTTTATCTGCACAACAATGG - Intronic
1084395554 11:68907324-68907346 CATGTTTACCAGCTGGACCAAGG - Intronic
1084424838 11:69079007-69079029 CTACTTTACCAGCAGGACAACGG - Exonic
1085183751 11:74558072-74558094 GCTGATAACCAGCAGGACAATGG + Intronic
1086212897 11:84342274-84342296 CCAATTTACCAGCACCAGAAAGG + Intronic
1089473892 11:118742961-118742983 ACTGTTTACCAGGGAGACAAGGG - Intergenic
1091809967 12:3389019-3389041 CCTGCTTGCCAGCACCACACTGG + Intronic
1093162019 12:15758439-15758461 TCTGTTGAACAGCACGACCATGG - Intronic
1099418771 12:82426564-82426586 ACTATTTACCACCACAACAAAGG - Intronic
1104289083 12:127452095-127452117 CATGTTAACCAGCATGGCAAAGG - Intergenic
1108440645 13:50449605-50449627 CCTGTTTCCCAGGAAGATAATGG + Intronic
1110438505 13:75502252-75502274 CCTTATTAGCAGCACGAGAATGG - Intergenic
1113817655 13:113185544-113185566 CCTCTATACCAGCACGGCTATGG + Exonic
1126095568 15:45087303-45087325 CTTGTTTTCCAGAACGACAGTGG + Intergenic
1127050995 15:55083881-55083903 CAAGTTTACCAGCAGAACAATGG + Intergenic
1127912859 15:63432468-63432490 ACTGTTTACCAGAAGCACAAGGG - Intergenic
1128474240 15:67983440-67983462 CCTTTATAGCAGCACGAGAATGG + Intergenic
1131256648 15:90867282-90867304 CCAGTATGCCAGCACAACAATGG - Intergenic
1135534955 16:23286683-23286705 CCATTCTACCAGCAAGACAATGG + Intronic
1144600211 17:16606307-16606329 CTTCTTGACCAGCACCACAATGG - Intergenic
1155324191 18:24649680-24649702 AATGTTTACCAGCACGTCATTGG + Intergenic
1156485904 18:37465481-37465503 TCTGTGTACCAGCACCTCAAAGG + Intronic
1158330604 18:56358294-56358316 CTTGTTAACCAGCATGAAAATGG + Intergenic
1159605906 18:70474628-70474650 CCAGTTTACCAGCACAACACTGG - Intergenic
1160014431 18:75129433-75129455 CCGTTTTCCCAGCAGGACAAAGG + Intergenic
1162693731 19:12455039-12455061 GCTGCTTACCAGCATGTCAAAGG - Intronic
1165467506 19:35983734-35983756 CCTGGTTACCAGGACCCCAAGGG - Intergenic
931852085 2:66262084-66262106 CTTCTTTCCCAGCACGACAGTGG + Intergenic
941035659 2:160566451-160566473 TCTGTTTACCAGTGTGACAATGG + Intergenic
944474052 2:200085757-200085779 CCTGTACACCAGCACCACAGGGG - Intergenic
946657074 2:221960145-221960167 CCTTTTTAGCAGCATGAGAATGG - Intergenic
947766333 2:232640227-232640249 CCTGTTTACCAGTTGGACCAGGG - Intronic
1170519533 20:17169658-17169680 GCTGTTTACCAGCCTCACAAAGG + Intergenic
1171108228 20:22456388-22456410 CCTTTTCACCAGCACAATAAGGG - Intergenic
1175530828 20:59673455-59673477 CCAGGTCAGCAGCACGACAAGGG + Intronic
1181941284 22:26479424-26479446 CCTGTTTCCCAGCCCGAGGAGGG + Intronic
960645267 3:119873485-119873507 CCTGTTTACCTGCCCTCCAAGGG + Intronic
962285382 3:134081491-134081513 CCTGTTTCCCAGCTCCACAAGGG - Intronic
963584009 3:147161316-147161338 CCTGTTTAGTAGAACTACAAAGG - Intergenic
971830044 4:31680224-31680246 GCTGTTTGCCACCACCACAATGG - Intergenic
973240388 4:47950248-47950270 CTTATTTACTAGCACGAGAATGG - Intronic
973630154 4:52812684-52812706 CCAGTTTACAAACAGGACAAAGG + Intergenic
983437173 4:167730860-167730882 AATGTTTACCACCAAGACAATGG + Intergenic
993305928 5:86275331-86275353 CCTGTCTACCATCACAAAAATGG + Intergenic
999894522 5:156015558-156015580 CCTGTTTACCAGACAGAAAAAGG + Intronic
1000304827 5:159985672-159985694 GCTATTTACCAGCACACCAAAGG + Intergenic
1001827603 5:174758410-174758432 CATGTTTCCCAGCACAATAAAGG + Intergenic
1002082203 5:176743689-176743711 CCTGTTTACCAGCACGACAACGG + Intergenic
1003256699 6:4481508-4481530 GCTGTTTATCAGCACGTCAGTGG - Intergenic
1008115403 6:47543722-47543744 CCTATTTACCACCCCCACAAAGG + Intronic
1008960640 6:57262216-57262238 CCACTTTACCAGCAAGAAAACGG - Intergenic
1011173701 6:84536324-84536346 TCTGTTTAACAGCATAACAAGGG - Intergenic
1017189159 6:151633557-151633579 CCTGTTTATCAGCAGTAAAATGG + Intergenic
1023157329 7:37263980-37264002 CGTGTTTACCAATAGGACAATGG + Intronic
1035304773 7:157924569-157924591 CCTGTTTTCCAGCTCAAGAATGG - Intronic
1035304929 7:157925819-157925841 TCTGTTTACCATCACGTCACTGG - Intronic
1037890358 8:22620905-22620927 CCAGCTTCCCAGCAAGACAAAGG - Exonic
1039870258 8:41539991-41540013 CCTGTTTACCTGCCCGAAAGAGG - Exonic
1044400386 8:91763995-91764017 CAGGTTTACCAGCACAACATTGG + Intergenic
1045884964 8:107084769-107084791 CTTGTTTACCAGAATGCCAATGG + Intergenic
1053461216 9:38272869-38272891 CCTGGTTAGCAGCCTGACAAAGG - Intergenic
1057387684 9:94618918-94618940 CCAGTTTACCAGCACATCACTGG + Intronic
1188118944 X:26281046-26281068 GCTGTACACCAGCATGACAAAGG + Intergenic
1196895424 X:120331174-120331196 GTTGCTTACCAGCACGCCAAAGG + Intergenic
1197464162 X:126783274-126783296 CCTTTATAGCAGCATGACAATGG + Intergenic
1197471820 X:126872825-126872847 CCTTTTTAGCAGCATGAGAATGG - Intergenic
1198531126 X:137550166-137550188 CATTTTTACCAGCACGTCCAGGG - Intergenic