ID: 1002082510

View in Genome Browser
Species Human (GRCh38)
Location 5:176745894-176745916
Sequence GGGGACTGGGTGTGTGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002082500_1002082510 30 Left 1002082500 5:176745841-176745863 CCTGTGGGTGTGAGCGTGGGGAT No data
Right 1002082510 5:176745894-176745916 GGGGACTGGGTGTGTGGAAGGGG No data
1002082504_1002082510 -8 Left 1002082504 5:176745879-176745901 CCTGTGTGTGTGCGCGGGGACTG No data
Right 1002082510 5:176745894-176745916 GGGGACTGGGTGTGTGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002082510 Original CRISPR GGGGACTGGGTGTGTGGAAG GGG Intergenic
No off target data available for this crispr