ID: 1002085324

View in Genome Browser
Species Human (GRCh38)
Location 5:176771284-176771306
Sequence CCACCCTGCCTGGGTTACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002085315_1002085324 10 Left 1002085315 5:176771251-176771273 CCAGCCTGGGTTACATGGGAACC No data
Right 1002085324 5:176771284-176771306 CCACCCTGCCTGGGTTACATGGG No data
1002085310_1002085324 15 Left 1002085310 5:176771246-176771268 CCCACCCAGCCTGGGTTACATGG No data
Right 1002085324 5:176771284-176771306 CCACCCTGCCTGGGTTACATGGG No data
1002085312_1002085324 14 Left 1002085312 5:176771247-176771269 CCACCCAGCCTGGGTTACATGGG No data
Right 1002085324 5:176771284-176771306 CCACCCTGCCTGGGTTACATGGG No data
1002085314_1002085324 11 Left 1002085314 5:176771250-176771272 CCCAGCCTGGGTTACATGGGAAC No data
Right 1002085324 5:176771284-176771306 CCACCCTGCCTGGGTTACATGGG No data
1002085307_1002085324 26 Left 1002085307 5:176771235-176771257 CCAAGCTACAGCCCACCCAGCCT No data
Right 1002085324 5:176771284-176771306 CCACCCTGCCTGGGTTACATGGG No data
1002085316_1002085324 6 Left 1002085316 5:176771255-176771277 CCTGGGTTACATGGGAACCAACC No data
Right 1002085324 5:176771284-176771306 CCACCCTGCCTGGGTTACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002085324 Original CRISPR CCACCCTGCCTGGGTTACAT GGG Intergenic
No off target data available for this crispr