ID: 1002085334

View in Genome Browser
Species Human (GRCh38)
Location 5:176771321-176771343
Sequence CCACCCTGCCTGGGTTACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002085327_1002085334 6 Left 1002085327 5:176771292-176771314 CCTGGGTTACATGGGAACCAAGC No data
Right 1002085334 5:176771321-176771343 CCACCCTGCCTGGGTTACATGGG No data
1002085326_1002085334 10 Left 1002085326 5:176771288-176771310 CCTGCCTGGGTTACATGGGAACC No data
Right 1002085334 5:176771321-176771343 CCACCCTGCCTGGGTTACATGGG No data
1002085317_1002085334 26 Left 1002085317 5:176771272-176771294 CCAACCTGCAGCCCACCCTGCCT No data
Right 1002085334 5:176771321-176771343 CCACCCTGCCTGGGTTACATGGG No data
1002085320_1002085334 22 Left 1002085320 5:176771276-176771298 CCTGCAGCCCACCCTGCCTGGGT No data
Right 1002085334 5:176771321-176771343 CCACCCTGCCTGGGTTACATGGG No data
1002085321_1002085334 15 Left 1002085321 5:176771283-176771305 CCCACCCTGCCTGGGTTACATGG No data
Right 1002085334 5:176771321-176771343 CCACCCTGCCTGGGTTACATGGG No data
1002085325_1002085334 11 Left 1002085325 5:176771287-176771309 CCCTGCCTGGGTTACATGGGAAC No data
Right 1002085334 5:176771321-176771343 CCACCCTGCCTGGGTTACATGGG No data
1002085323_1002085334 14 Left 1002085323 5:176771284-176771306 CCACCCTGCCTGGGTTACATGGG No data
Right 1002085334 5:176771321-176771343 CCACCCTGCCTGGGTTACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002085334 Original CRISPR CCACCCTGCCTGGGTTACAT GGG Intergenic
No off target data available for this crispr