ID: 1002087876

View in Genome Browser
Species Human (GRCh38)
Location 5:176787001-176787023
Sequence TCTCATGTTCAGGCTGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002087874_1002087876 -6 Left 1002087874 5:176786984-176787006 CCTTTTAGAGGCAGTTTTCTCAT No data
Right 1002087876 5:176787001-176787023 TCTCATGTTCAGGCTGTAGATGG No data
1002087873_1002087876 -5 Left 1002087873 5:176786983-176787005 CCCTTTTAGAGGCAGTTTTCTCA No data
Right 1002087876 5:176787001-176787023 TCTCATGTTCAGGCTGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002087876 Original CRISPR TCTCATGTTCAGGCTGTAGA TGG Intergenic
No off target data available for this crispr