ID: 1002088782

View in Genome Browser
Species Human (GRCh38)
Location 5:176792605-176792627
Sequence CCCACCTGGCACAAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002088768_1002088782 21 Left 1002088768 5:176792561-176792583 CCTCCTTCCACCCCAGGTGCTCA No data
Right 1002088782 5:176792605-176792627 CCCACCTGGCACAAGCTGGAGGG No data
1002088776_1002088782 -9 Left 1002088776 5:176792591-176792613 CCTGTGCCAGGAAGCCCACCTGG No data
Right 1002088782 5:176792605-176792627 CCCACCTGGCACAAGCTGGAGGG No data
1002088771_1002088782 11 Left 1002088771 5:176792571-176792593 CCCCAGGTGCTCAAGTGTTCCCT No data
Right 1002088782 5:176792605-176792627 CCCACCTGGCACAAGCTGGAGGG No data
1002088770_1002088782 14 Left 1002088770 5:176792568-176792590 CCACCCCAGGTGCTCAAGTGTTC No data
Right 1002088782 5:176792605-176792627 CCCACCTGGCACAAGCTGGAGGG No data
1002088773_1002088782 9 Left 1002088773 5:176792573-176792595 CCAGGTGCTCAAGTGTTCCCTGT No data
Right 1002088782 5:176792605-176792627 CCCACCTGGCACAAGCTGGAGGG No data
1002088769_1002088782 18 Left 1002088769 5:176792564-176792586 CCTTCCACCCCAGGTGCTCAAGT No data
Right 1002088782 5:176792605-176792627 CCCACCTGGCACAAGCTGGAGGG No data
1002088766_1002088782 28 Left 1002088766 5:176792554-176792576 CCAGGTGCCTCCTTCCACCCCAG No data
Right 1002088782 5:176792605-176792627 CCCACCTGGCACAAGCTGGAGGG No data
1002088775_1002088782 -8 Left 1002088775 5:176792590-176792612 CCCTGTGCCAGGAAGCCCACCTG No data
Right 1002088782 5:176792605-176792627 CCCACCTGGCACAAGCTGGAGGG No data
1002088772_1002088782 10 Left 1002088772 5:176792572-176792594 CCCAGGTGCTCAAGTGTTCCCTG No data
Right 1002088782 5:176792605-176792627 CCCACCTGGCACAAGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002088782 Original CRISPR CCCACCTGGCACAAGCTGGA GGG Intergenic
No off target data available for this crispr