ID: 1002089978

View in Genome Browser
Species Human (GRCh38)
Location 5:176798656-176798678
Sequence ACTTCAGGGTGGGATCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002089978_1002089993 14 Left 1002089978 5:176798656-176798678 CCTCCAAGATCCCACCCTGAAGT No data
Right 1002089993 5:176798693-176798715 CAGGAATTGGTTCCAGGACTCGG No data
1002089978_1002089989 1 Left 1002089978 5:176798656-176798678 CCTCCAAGATCCCACCCTGAAGT No data
Right 1002089989 5:176798680-176798702 GCTGAGGTGGGCCCAGGAATTGG No data
1002089978_1002089988 -5 Left 1002089978 5:176798656-176798678 CCTCCAAGATCCCACCCTGAAGT No data
Right 1002089988 5:176798674-176798696 GAAGTGGCTGAGGTGGGCCCAGG No data
1002089978_1002089997 26 Left 1002089978 5:176798656-176798678 CCTCCAAGATCCCACCCTGAAGT No data
Right 1002089997 5:176798705-176798727 CCAGGACTCGGGGAGCCGCGCGG No data
1002089978_1002089995 16 Left 1002089978 5:176798656-176798678 CCTCCAAGATCCCACCCTGAAGT No data
Right 1002089995 5:176798695-176798717 GGAATTGGTTCCAGGACTCGGGG No data
1002089978_1002089990 8 Left 1002089978 5:176798656-176798678 CCTCCAAGATCCCACCCTGAAGT No data
Right 1002089990 5:176798687-176798709 TGGGCCCAGGAATTGGTTCCAGG No data
1002089978_1002089999 28 Left 1002089978 5:176798656-176798678 CCTCCAAGATCCCACCCTGAAGT No data
Right 1002089999 5:176798707-176798729 AGGACTCGGGGAGCCGCGCGGGG No data
1002089978_1002089994 15 Left 1002089978 5:176798656-176798678 CCTCCAAGATCCCACCCTGAAGT No data
Right 1002089994 5:176798694-176798716 AGGAATTGGTTCCAGGACTCGGG No data
1002089978_1002089998 27 Left 1002089978 5:176798656-176798678 CCTCCAAGATCCCACCCTGAAGT No data
Right 1002089998 5:176798706-176798728 CAGGACTCGGGGAGCCGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002089978 Original CRISPR ACTTCAGGGTGGGATCTTGG AGG (reversed) Intergenic
No off target data available for this crispr