ID: 1002090094

View in Genome Browser
Species Human (GRCh38)
Location 5:176799213-176799235
Sequence ACCCTGCTTGGGTCTCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002090079_1002090094 22 Left 1002090079 5:176799168-176799190 CCTGAGCAGGGCTGACCCCACCT No data
Right 1002090094 5:176799213-176799235 ACCCTGCTTGGGTCTCCCAGGGG No data
1002090082_1002090094 6 Left 1002090082 5:176799184-176799206 CCCACCTCAGAGAAGGCAGAGCC No data
Right 1002090094 5:176799213-176799235 ACCCTGCTTGGGTCTCCCAGGGG No data
1002090085_1002090094 2 Left 1002090085 5:176799188-176799210 CCTCAGAGAAGGCAGAGCCCGGG No data
Right 1002090094 5:176799213-176799235 ACCCTGCTTGGGTCTCCCAGGGG No data
1002090083_1002090094 5 Left 1002090083 5:176799185-176799207 CCACCTCAGAGAAGGCAGAGCCC No data
Right 1002090094 5:176799213-176799235 ACCCTGCTTGGGTCTCCCAGGGG No data
1002090081_1002090094 7 Left 1002090081 5:176799183-176799205 CCCCACCTCAGAGAAGGCAGAGC No data
Right 1002090094 5:176799213-176799235 ACCCTGCTTGGGTCTCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002090094 Original CRISPR ACCCTGCTTGGGTCTCCCAG GGG Intergenic