ID: 1002091274

View in Genome Browser
Species Human (GRCh38)
Location 5:176807992-176808014
Sequence TGAGGTTTGAGATACAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002091274_1002091280 16 Left 1002091274 5:176807992-176808014 CCTTTCCTGTATCTCAAACCTCA No data
Right 1002091280 5:176808031-176808053 CCCAGAGTAGAAACTGTAGCAGG No data
1002091274_1002091282 29 Left 1002091274 5:176807992-176808014 CCTTTCCTGTATCTCAAACCTCA No data
Right 1002091282 5:176808044-176808066 CTGTAGCAGGAGAAAAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002091274 Original CRISPR TGAGGTTTGAGATACAGGAA AGG (reversed) Intergenic
No off target data available for this crispr