ID: 1002091278

View in Genome Browser
Species Human (GRCh38)
Location 5:176808019-176808041
Sequence TCTACTCTGGGATTTGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002091278_1002091282 2 Left 1002091278 5:176808019-176808041 CCAAATTCAAATCCCAGAGTAGA No data
Right 1002091282 5:176808044-176808066 CTGTAGCAGGAGAAAAGATGAGG No data
1002091278_1002091283 8 Left 1002091278 5:176808019-176808041 CCAAATTCAAATCCCAGAGTAGA No data
Right 1002091283 5:176808050-176808072 CAGGAGAAAAGATGAGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002091278 Original CRISPR TCTACTCTGGGATTTGAATT TGG (reversed) Intergenic
No off target data available for this crispr