ID: 1002091279

View in Genome Browser
Species Human (GRCh38)
Location 5:176808031-176808053
Sequence CCTGCTACAGTTTCTACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002091279_1002091284 20 Left 1002091279 5:176808031-176808053 CCCAGAGTAGAAACTGTAGCAGG No data
Right 1002091284 5:176808074-176808096 CGTTGAAACCAAACCTCCCAAGG No data
1002091279_1002091283 -4 Left 1002091279 5:176808031-176808053 CCCAGAGTAGAAACTGTAGCAGG No data
Right 1002091283 5:176808050-176808072 CAGGAGAAAAGATGAGGACACGG No data
1002091279_1002091282 -10 Left 1002091279 5:176808031-176808053 CCCAGAGTAGAAACTGTAGCAGG No data
Right 1002091282 5:176808044-176808066 CTGTAGCAGGAGAAAAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002091279 Original CRISPR CCTGCTACAGTTTCTACTCT GGG (reversed) Intergenic
No off target data available for this crispr