ID: 1002091282

View in Genome Browser
Species Human (GRCh38)
Location 5:176808044-176808066
Sequence CTGTAGCAGGAGAAAAGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002091276_1002091282 11 Left 1002091276 5:176808010-176808032 CCTCATTTCCCAAATTCAAATCC No data
Right 1002091282 5:176808044-176808066 CTGTAGCAGGAGAAAAGATGAGG No data
1002091274_1002091282 29 Left 1002091274 5:176807992-176808014 CCTTTCCTGTATCTCAAACCTCA No data
Right 1002091282 5:176808044-176808066 CTGTAGCAGGAGAAAAGATGAGG No data
1002091275_1002091282 24 Left 1002091275 5:176807997-176808019 CCTGTATCTCAAACCTCATTTCC No data
Right 1002091282 5:176808044-176808066 CTGTAGCAGGAGAAAAGATGAGG No data
1002091278_1002091282 2 Left 1002091278 5:176808019-176808041 CCAAATTCAAATCCCAGAGTAGA No data
Right 1002091282 5:176808044-176808066 CTGTAGCAGGAGAAAAGATGAGG No data
1002091277_1002091282 3 Left 1002091277 5:176808018-176808040 CCCAAATTCAAATCCCAGAGTAG No data
Right 1002091282 5:176808044-176808066 CTGTAGCAGGAGAAAAGATGAGG No data
1002091279_1002091282 -10 Left 1002091279 5:176808031-176808053 CCCAGAGTAGAAACTGTAGCAGG No data
Right 1002091282 5:176808044-176808066 CTGTAGCAGGAGAAAAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002091282 Original CRISPR CTGTAGCAGGAGAAAAGATG AGG Intergenic
No off target data available for this crispr