ID: 1002091283

View in Genome Browser
Species Human (GRCh38)
Location 5:176808050-176808072
Sequence CAGGAGAAAAGATGAGGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002091281_1002091283 -5 Left 1002091281 5:176808032-176808054 CCAGAGTAGAAACTGTAGCAGGA No data
Right 1002091283 5:176808050-176808072 CAGGAGAAAAGATGAGGACACGG No data
1002091279_1002091283 -4 Left 1002091279 5:176808031-176808053 CCCAGAGTAGAAACTGTAGCAGG No data
Right 1002091283 5:176808050-176808072 CAGGAGAAAAGATGAGGACACGG No data
1002091275_1002091283 30 Left 1002091275 5:176807997-176808019 CCTGTATCTCAAACCTCATTTCC No data
Right 1002091283 5:176808050-176808072 CAGGAGAAAAGATGAGGACACGG No data
1002091277_1002091283 9 Left 1002091277 5:176808018-176808040 CCCAAATTCAAATCCCAGAGTAG No data
Right 1002091283 5:176808050-176808072 CAGGAGAAAAGATGAGGACACGG No data
1002091276_1002091283 17 Left 1002091276 5:176808010-176808032 CCTCATTTCCCAAATTCAAATCC No data
Right 1002091283 5:176808050-176808072 CAGGAGAAAAGATGAGGACACGG No data
1002091278_1002091283 8 Left 1002091278 5:176808019-176808041 CCAAATTCAAATCCCAGAGTAGA No data
Right 1002091283 5:176808050-176808072 CAGGAGAAAAGATGAGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002091283 Original CRISPR CAGGAGAAAAGATGAGGACA CGG Intergenic
No off target data available for this crispr