ID: 1002092198

View in Genome Browser
Species Human (GRCh38)
Location 5:176812112-176812134
Sequence GATTAGAAGGAGAGGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002092198_1002092203 -6 Left 1002092198 5:176812112-176812134 CCCCAGGGCCTCTCCTTCTAATC 0: 1
1: 0
2: 1
3: 12
4: 268
Right 1002092203 5:176812129-176812151 CTAATCCTGACCAAGCTGAGAGG 0: 1
1: 0
2: 1
3: 6
4: 87
1002092198_1002092207 10 Left 1002092198 5:176812112-176812134 CCCCAGGGCCTCTCCTTCTAATC 0: 1
1: 0
2: 1
3: 12
4: 268
Right 1002092207 5:176812145-176812167 TGAGAGGCTGAACTGCTGTTGGG 0: 1
1: 0
2: 1
3: 13
4: 160
1002092198_1002092206 9 Left 1002092198 5:176812112-176812134 CCCCAGGGCCTCTCCTTCTAATC 0: 1
1: 0
2: 1
3: 12
4: 268
Right 1002092206 5:176812144-176812166 CTGAGAGGCTGAACTGCTGTTGG 0: 1
1: 0
2: 2
3: 14
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002092198 Original CRISPR GATTAGAAGGAGAGGCCCTG GGG (reversed) Intronic
903587004 1:24423695-24423717 GGTTAGAAGCAGAGGGCATGTGG + Intronic
903846602 1:26282831-26282853 GATGAGGAGGTGAGGGCCTGGGG - Intronic
904448594 1:30596545-30596567 GACTAGAAGGACAGACCCTTTGG - Intergenic
904991753 1:34598809-34598831 CATTAGAAAGAGTGGCTCTGTGG - Intergenic
905262772 1:36731135-36731157 GGCTAGAAGGTGAGGTCCTGAGG + Intergenic
906368043 1:45227463-45227485 TATTAGAAGGTGAGGCCTTTGGG + Intronic
906714227 1:47955075-47955097 GTTTAGGAGGAGAGGCCAAGAGG - Intronic
908332326 1:63082984-63083006 GATTACAATGTAAGGCCCTGTGG - Intergenic
911237730 1:95429606-95429628 GATTAGAAGGTGAGGCCTTTGGG + Intergenic
911684960 1:100765126-100765148 GATTAGAAAGAGAAGACTTGAGG + Intergenic
914900521 1:151708957-151708979 GGTGGGAAGGAGAGGCCCGGGGG + Intronic
915633665 1:157171735-157171757 GATGAGAAGCTGTGGCCCTGGGG + Intergenic
915838002 1:159193376-159193398 GATAGGAAGGAGAGGCCCCATGG - Intronic
916592340 1:166204588-166204610 GATTAGTGGGAGTGGCACTGGGG - Intergenic
918101506 1:181379722-181379744 TATTAGAAGGTGAGGCCTTTAGG - Intergenic
920669933 1:207995791-207995813 GGGTTGAAGGAGATGCCCTGTGG + Intergenic
922825613 1:228515698-228515720 GATGAGAACAAGAGACCCTGGGG - Intergenic
922950860 1:229558087-229558109 GTGGAGAAGGAGAGGCCCGGCGG + Intronic
924895553 1:248334601-248334623 TATTAGAAGATGAGGCCTTGGGG - Intergenic
1064086141 10:12348419-12348441 AACTACGAGGAGAGGCCCTGAGG + Intergenic
1064447559 10:15409096-15409118 GATGAGAATGAGAAGCACTGGGG + Intergenic
1065231930 10:23607212-23607234 GTATAGAAAGAGAGACCCTGAGG + Intergenic
1065373713 10:25016051-25016073 GATGTGAAGGAGAGAACCTGTGG - Exonic
1065779981 10:29158223-29158245 GGTTGGAAGGAGAGGCCCCTGGG - Intergenic
1065862782 10:29885777-29885799 GAGAAGAAGGAGATGCCCTCTGG - Intergenic
1067069099 10:43119525-43119547 GATGAGGAGGAGCGGGCCTGGGG - Exonic
1069891189 10:71653361-71653383 GAGCAGAGGGAGAGGCCCTGTGG - Intronic
1069961623 10:72082477-72082499 GATTAGGAGGCGGGGCCTTGGGG + Intronic
1071240249 10:83697274-83697296 GATTTGAAGGGGAGGCTCTAGGG - Intergenic
1072432411 10:95384742-95384764 GGTGGGAAGGAGAGGCCCAGAGG + Intronic
1072536022 10:96363892-96363914 GATTAGATGAAGAGGCTTTGGGG - Intergenic
1073095909 10:100979715-100979737 GACTCACAGGAGAGGCCCTGTGG + Intronic
1073345530 10:102780086-102780108 TATTAGAAAGAAGGGCCCTGAGG - Intronic
1073760418 10:106623039-106623061 GTGTAGAAGCAAAGGCCCTGGGG - Intronic
1074549451 10:114429074-114429096 GACTAGAAGGAGAATCCATGAGG + Intergenic
1074638973 10:115356687-115356709 AATTAGAAGAAGAGATCCTGAGG - Intronic
1075796468 10:125123601-125123623 GCTTACAAGGAGGGGCCATGAGG + Intronic
1078275938 11:9846597-9846619 GTTTTGAAGGAAATGCCCTGTGG - Intronic
1080770783 11:35339375-35339397 GAGTATAAGAAGATGCCCTGTGG - Intronic
1080774765 11:35375442-35375464 GAGTAGAAGAAGCGGGCCTGGGG + Intronic
1081390995 11:42528690-42528712 GATTACAAGGATAGGCTTTGGGG - Intergenic
1081628550 11:44671431-44671453 GTTTGGAGGGAGAGGGCCTGCGG + Intergenic
1081810879 11:45913587-45913609 GGTTGGCAGGAGAGGCACTGAGG - Intronic
1082211283 11:49505455-49505477 GGAAAGAAGGAGATGCCCTGAGG + Intergenic
1082676478 11:56111138-56111160 GATAAGAAAGAGAGGCCCCATGG + Intergenic
1083685374 11:64371944-64371966 GTACTGAAGGAGAGGCCCTGGGG + Exonic
1085257248 11:75182118-75182140 GATTTGAAGCAGAGGCACGGTGG - Intronic
1085533908 11:77206963-77206985 GATTAGAAGGAGGAGACTTGAGG - Intronic
1088262948 11:107961402-107961424 GATTAGGAGGAGGGGCCTTTGGG - Intronic
1089168981 11:116499591-116499613 AATTAGAAGGCAAGGCCCTCAGG + Intergenic
1089498813 11:118921361-118921383 GATTAGAAGGCAATGCTCTGGGG + Intronic
1089587996 11:119522168-119522190 GATGAGAAACAGAGGGCCTGGGG + Intergenic
1090477526 11:127037137-127037159 GCTTTGAAGGAGTGTCCCTGAGG - Intergenic
1094120525 12:26969385-26969407 AATGAGAAGGGGAGGCCTTGAGG + Intergenic
1094600706 12:31906655-31906677 GATGGGAGGGAGAGGCTCTGGGG - Intergenic
1096473947 12:51896625-51896647 GATCTGAAGGAGAGGGCTTGAGG + Intergenic
1099576526 12:84390598-84390620 GAGGTGAAGGAGGGGCCCTGCGG + Intergenic
1099830995 12:87842618-87842640 GTTTAAAAGGAGTGGCTCTGAGG - Intergenic
1101385031 12:104249308-104249330 CATTAGAAGGAGGGGCCTTTGGG - Intronic
1101823452 12:108202077-108202099 GATTTGAAGGTGGAGCCCTGAGG + Intronic
1104770815 12:131363108-131363130 GATTAGGAGGGGAGGCCTTCGGG - Intergenic
1105580800 13:21693767-21693789 GAAGAGAAGGAGAGCCCCTGGGG + Intronic
1105838750 13:24234711-24234733 GAATAGAGAGAGGGGCCCTGTGG + Intronic
1106130228 13:26933601-26933623 GATTGGAAGGTGAGGCCTTTGGG + Intergenic
1107392491 13:39981803-39981825 GTGGAGAAAGAGAGGCCCTGAGG - Intergenic
1107817637 13:44258408-44258430 TATTAGAAGGTGAGGCCTTTGGG + Intergenic
1109299398 13:60575269-60575291 GCTTTGAAGGAGAGGTCCTCAGG + Intergenic
1110801878 13:79707672-79707694 GTTTATAAGTATAGGCCCTGGGG + Intergenic
1111873080 13:93858803-93858825 GAATAGGAGGAGAGTCACTGTGG + Intronic
1112029907 13:95447599-95447621 GAGGCAAAGGAGAGGCCCTGGGG - Intronic
1113068355 13:106393963-106393985 GCTTAGGAGGACAGGCCCAGGGG - Intergenic
1113298930 13:108995339-108995361 GATTAGAAGGTGGGGCCTTTGGG - Intronic
1113490178 13:110685406-110685428 GATGAGCACGTGAGGCCCTGAGG - Intronic
1113561802 13:111287238-111287260 GATGAGATGGTGAGGCCCTGGGG + Intronic
1119474156 14:74917602-74917624 GATTAGAAGGACAGACAATGAGG - Intronic
1121319276 14:92981584-92981606 CATAAGAAGGAGATGCACTGGGG - Intronic
1121418777 14:93797850-93797872 CATTAGAAGGTGAGGTCTTGGGG - Intergenic
1121997341 14:98613483-98613505 GATAAGCAGGCGAGGCACTGAGG - Intergenic
1122616309 14:103020346-103020368 GGTTACAAGGAGAGGACCTCAGG - Intronic
1124663588 15:31571349-31571371 GATGAGAAGGAAAGGCGCAGAGG + Intronic
1125512988 15:40302782-40302804 GATGGGAAGGAGAGGCCCTGAGG + Intronic
1125712447 15:41797899-41797921 GGTTGGAAGGAAATGCCCTGTGG - Intronic
1125930417 15:43595716-43595738 CATTGGAAGAAGAGGCCCTTTGG - Intronic
1125943585 15:43695548-43695570 CATTGGAAGAAGAGGCCCTTTGG - Intronic
1126758925 15:51951096-51951118 GATTTGTAAGAAAGGCCCTGAGG + Intronic
1128712315 15:69881387-69881409 GACTATGAGGAGAGGCCCAGGGG - Intergenic
1130092074 15:80829453-80829475 TTTTAAAAGGAGAGGCTCTGTGG - Intronic
1130981553 15:88815189-88815211 GAATGGAAGGGGAGGTCCTGTGG + Intronic
1132801795 16:1758274-1758296 GAGCAGAAGCAGAGGCGCTGCGG - Intronic
1135972907 16:27085215-27085237 CATTAGAAGGAGCCGCTCTGTGG - Intergenic
1137020489 16:35420961-35420983 GGTAAGAAAGAGAGGGCCTGGGG + Intergenic
1139510743 16:67427189-67427211 GCTGAGAAGGAGAGGCAGTGAGG + Intergenic
1140307876 16:73820480-73820502 GTTTACAGGGAGAGGCCATGTGG + Intergenic
1141229311 16:82149953-82149975 GAGTTGGAGGAGAGACCCTGTGG - Intronic
1142810831 17:2394875-2394897 GAACAGAAGAAGAGGCCCGGGGG - Exonic
1144802354 17:17938478-17938500 GACTACCAGGAGAGGCACTGGGG + Intronic
1146630073 17:34463399-34463421 GCACAGAGGGAGAGGCCCTGGGG - Intergenic
1147218536 17:38914825-38914847 GATTGAAAGGAGAGGCCCCCAGG + Intronic
1147766819 17:42842424-42842446 GATGAGAAGCAGAGGGCTTGGGG + Exonic
1148284298 17:46373865-46373887 CCTTAAAAGGAGAGGCCATGGGG - Intergenic
1148306519 17:46591786-46591808 CCTTAAAAGGAGAGGCCATGGGG - Intronic
1148329620 17:46805964-46805986 GATGAGAAACTGAGGCCCTGAGG - Intronic
1148492056 17:48029543-48029565 AGTTAGGAAGAGAGGCCCTGGGG + Intronic
1152261559 17:79269972-79269994 GAGAAGCAGCAGAGGCCCTGAGG - Intronic
1152541734 17:80980044-80980066 GATGGGCAGGAGCGGCCCTGAGG - Intergenic
1153136697 18:1925716-1925738 GATGAGCAGGAGAGGCCAGGAGG - Intergenic
1153171471 18:2320836-2320858 CAATAGGTGGAGAGGCCCTGAGG + Intergenic
1156504958 18:37584542-37584564 GAGGAGAAGGAGAGGCTCTCAGG - Intergenic
1157774961 18:50386314-50386336 TCTTAGGAGGAGAGTCCCTGAGG + Intronic
1157993987 18:52532964-52532986 GATTAGTAGAAGAGGGACTGGGG - Intronic
1159107072 18:64014916-64014938 GCTTAATAGGAGAGGGCCTGAGG - Intergenic
1161801565 19:6419172-6419194 CATCACAATGAGAGGCCCTGTGG + Intronic
1165329873 19:35135430-35135452 GGGTGGGAGGAGAGGCCCTGGGG + Intronic
1165334804 19:35162245-35162267 GAGGAGGAAGAGAGGCCCTGGGG - Intronic
1166856348 19:45784274-45784296 GGTTGGGAGGAGATGCCCTGGGG + Exonic
1167157542 19:47748547-47748569 GAGTGGAAGGAGCTGCCCTGAGG + Intronic
1167377831 19:49120871-49120893 GATTGGAAGGTGAGAGCCTGAGG - Intronic
1167622949 19:50568882-50568904 GATGGGCAGGAGAGGCCCAGGGG + Intergenic
1167711357 19:51113316-51113338 GACTAGGAGCAGAGGCCATGGGG - Intergenic
1168413366 19:56153811-56153833 GAATTGAAGGGGAGGCCCTGGGG + Intronic
1168629105 19:57943381-57943403 GGTCAGATGGACAGGCCCTGTGG - Intronic
925656081 2:6150966-6150988 GATTTGCAAGAAAGGCCCTGTGG - Intergenic
927096805 2:19753565-19753587 GTTTAGAAGGTGAGACTCTGGGG - Intergenic
927353295 2:22144322-22144344 AATTATAATGAGAGGACCTGTGG + Intergenic
928114726 2:28538667-28538689 GATAAGATGGAGGGGGCCTGAGG + Intronic
929399679 2:41565599-41565621 GCTGAAAAGGAAAGGCCCTGAGG + Intergenic
929536850 2:42789127-42789149 GTTTATAAGCACAGGCCCTGGGG + Intronic
934168710 2:89321135-89321157 AATGGGAGGGAGAGGCCCTGGGG + Intergenic
934198580 2:89861448-89861470 AATGGGAGGGAGAGGCCCTGGGG - Intergenic
935023011 2:99249911-99249933 TAGTAGACGGAGTGGCCCTGTGG + Intronic
935669713 2:105544716-105544738 GATGAGAAGGTGAGTCCCTAGGG + Intergenic
935847067 2:107177385-107177407 GAGGAGAAGGAGAAGCCCAGAGG - Intergenic
936048797 2:109207055-109207077 CATTTGGAGGAGAGGGCCTGGGG + Intronic
938000314 2:127729313-127729335 CCTTAAGAGGAGAGGCCCTGGGG - Intronic
939135976 2:138294134-138294156 GACTAGATGCAGTGGCCCTGAGG - Intergenic
940158079 2:150680479-150680501 TATTAGAAGGTGAGGCCTTTGGG - Intergenic
944157577 2:196623431-196623453 GACTGGAAGGAGGGGCCCTCAGG + Intergenic
946037501 2:216755600-216755622 GTTGAGGAGGAGAGGCCGTGGGG + Intergenic
947177879 2:227385647-227385669 GTTTAGAAGGGGATACCCTGAGG - Intergenic
947744674 2:232501425-232501447 GATGGGAAGGAGAGGGGCTGTGG + Intergenic
948023278 2:234754815-234754837 GATTAGAATGACAGGCGCTCAGG - Intergenic
1169713441 20:8589987-8590009 TATTAGGAGGAGGGGCCTTGGGG - Intronic
1171852466 20:30318299-30318321 GGTAAGTAGGAAAGGCCCTGTGG - Intergenic
1172109220 20:32535809-32535831 AGTTAGAAGGAGAGGGGCTGGGG + Intronic
1172176076 20:32972689-32972711 GTGTCCAAGGAGAGGCCCTGGGG + Intergenic
1172484561 20:35290668-35290690 GCTGAGAAGGCGAGGCACTGGGG + Intronic
1173489663 20:43469477-43469499 GATTAGAAGGCCAGGCACAGTGG - Intergenic
1174878917 20:54255833-54255855 CATTAGAAGCAGATGCCATGAGG - Intergenic
1175777583 20:61662970-61662992 GGGGAGGAGGAGAGGCCCTGAGG - Intronic
1176072316 20:63233780-63233802 AAGTGGAAGGAAAGGCCCTGGGG - Intergenic
1176080420 20:63269809-63269831 GAATAGAAGGGGAGGGTCTGTGG - Intronic
1177898507 21:26884146-26884168 CATTAGATGGTGAGGCCTTGGGG + Intergenic
1178014431 21:28327487-28327509 GATTTGAGGGAGGGGCTCTGAGG + Intergenic
1179028981 21:37703583-37703605 CATTATAAGAAGAGACCCTGGGG + Intronic
1179126939 21:38599149-38599171 GGTAAGAAGGAGAGGCCATGGGG + Intronic
1179571102 21:42279396-42279418 GCTAACACGGAGAGGCCCTGTGG + Intronic
1179598696 21:42461169-42461191 GATTATAAGGAGCAGCACTGAGG + Intergenic
1180012565 21:45060504-45060526 GCTTTGAAAGAGAAGCCCTGTGG + Intergenic
1180127568 21:45802682-45802704 CATGGGGAGGAGAGGCCCTGAGG + Intronic
1180639270 22:17285093-17285115 GGCTTGAAGGAGAGGCTCTGCGG + Intergenic
1180976707 22:19852598-19852620 GAATGGAAGGAGGGGCCCAGGGG + Intronic
1181742744 22:24934350-24934372 GGCTAGAAGGAGAGGCACAGGGG + Intergenic
1182871194 22:33649183-33649205 GAGGACAAGGAGAGCCCCTGAGG - Intronic
1184264711 22:43340983-43341005 GCAAAGAAGGAGAAGCCCTGGGG - Intronic
1184825283 22:46946426-46946448 GACAAGAAGGAGAGTCACTGAGG - Intronic
1185402490 22:50626125-50626147 GGTTCCAAGGAGAGGGCCTGCGG + Intronic
949095194 3:77354-77376 GATAAGAAGGAGGGACCCTGGGG - Intergenic
950176786 3:10880645-10880667 GACTAGATGGAGCAGCCCTGGGG - Intronic
950467393 3:13163395-13163417 GATGCGAAGGAGAGGCCAGGAGG - Intergenic
951016565 3:17739050-17739072 CATTTGACGGAGAGGGCCTGTGG - Intronic
951252093 3:20405676-20405698 GAGCAGATGGAGAGGTCCTGTGG - Intergenic
951389318 3:22083156-22083178 GAGTAGAAGAAGAGGCGCTTTGG - Intronic
953098526 3:39803073-39803095 GACTAGACCGAGAGGTCCTGTGG - Intergenic
957242274 3:77674511-77674533 GATTAGAAAGAGAGGCCTTTGGG + Intergenic
957950917 3:87125331-87125353 GGTTACAAGCAAAGGCCCTGGGG + Intergenic
959566063 3:107834399-107834421 GCTTAGAAGAAGATGCCCAGGGG + Intergenic
960913984 3:122679199-122679221 GATGAGATGTAAAGGCCCTGGGG + Intergenic
961096882 3:124164940-124164962 AAATATAAGGAGAGGCCCAGAGG - Intronic
962528717 3:136258770-136258792 AAGGTGAAGGAGAGGCCCTGTGG + Intronic
963849674 3:150198431-150198453 GAGTAGGAGGGGAGCCCCTGGGG + Intergenic
964256389 3:154779113-154779135 GAATAGGAGAAGAAGCCCTGAGG - Intergenic
965938216 3:174142587-174142609 GAATACAAGCAAAGGCCCTGAGG + Intronic
967793667 3:193575372-193575394 GAGTAGAAGGTGAGACCCTAGGG + Intronic
968081187 3:195847827-195847849 GATGAGCAGGAGAAGCACTGGGG - Intergenic
968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG + Intergenic
969120990 4:4911049-4911071 TATTAGGAGGTGAGGCCTTGGGG - Intergenic
969287695 4:6215416-6215438 TATTAAGAGGTGAGGCCCTGTGG + Intergenic
972103716 4:35455596-35455618 GATGAGAAAGAGAGACACTGAGG - Intergenic
972972204 4:44591505-44591527 GAAAAGAATGAGAGGCCATGAGG + Intergenic
976591910 4:86857845-86857867 GATTAGAAGCAAACGCCCGGTGG + Intergenic
978757996 4:112324940-112324962 GAGAAGAAGGAGAGTCACTGAGG + Intronic
978771305 4:112458911-112458933 GACTAGAAGCAAAGGCCCTCTGG + Intergenic
979492087 4:121339706-121339728 GAGTACAAGGAGAGGCCAAGGGG + Intronic
983064870 4:163196863-163196885 GATTAGAATGAGATGATCTGAGG - Intergenic
983855587 4:172640066-172640088 GAATAGAAGGAGAGGAATTGGGG - Intronic
983863678 4:172737934-172737956 GATTATAAAGAGGGGACCTGGGG + Intronic
984163526 4:176282377-176282399 AACTAGAAGCAGAGGCCGTGGGG + Intergenic
984468902 4:180140164-180140186 GATTAGAAGGTGGGGCCTTTGGG - Intergenic
985430932 4:189879355-189879377 GATTTTAAGGAGAGGCCCCAAGG - Intergenic
986214516 5:5706968-5706990 GATTAGGAGGTGAGGCTTTGGGG + Intergenic
986694955 5:10343539-10343561 GATAAGAAGGAAAGGATCTGAGG + Intergenic
986695589 5:10352266-10352288 GATCAGAAGGAGAGGGGCTGGGG + Intergenic
987391222 5:17377187-17377209 GATTGGAAGGAGAGCGGCTGGGG + Intergenic
988837430 5:35047006-35047028 GAGTAGATGGGGAGGGCCTGGGG + Intronic
989246779 5:39264015-39264037 TATTAGAAGGTGAGGCCTTTGGG + Intronic
991484790 5:67123791-67123813 GATTAGAAGGAAAGGCAAAGTGG - Intronic
992988667 5:82260382-82260404 GATAAGCAGGAAAGGGCCTGGGG - Intronic
993277145 5:85874555-85874577 TATTAACAGGAGAGGCCCTTAGG - Intergenic
993424478 5:87746213-87746235 GATTAGACAGAGAGGCCATAGGG - Intergenic
995568086 5:113452373-113452395 TATTAGAAGGTGAGGCCTTTGGG + Intronic
995589320 5:113682842-113682864 GATTAGCTGGCCAGGCCCTGTGG + Intergenic
997571652 5:134932926-134932948 TATTAGAATGAGAGGCCTGGTGG - Intronic
998370313 5:141656490-141656512 GAGAAGAAAGTGAGGCCCTGGGG - Exonic
1000055924 5:157606165-157606187 GATTAGAAGGGGAGGACATCTGG - Intergenic
1001171087 5:169419584-169419606 GATTAGAAGGAGAGACTGTCAGG - Intergenic
1001494261 5:172176819-172176841 CATTAGAAGGAGGGGCCTTTTGG + Intronic
1002092198 5:176812112-176812134 GATTAGAAGGAGAGGCCCTGGGG - Intronic
1002276663 5:178108393-178108415 GGGTAGAAGGAGGGGCCTTGAGG + Intergenic
1002615692 5:180454313-180454335 GAGGCAAAGGAGAGGCCCTGGGG + Intergenic
1003217350 6:4126544-4126566 GATCTGAAGGAGAGGCCAGGTGG + Intronic
1003503639 6:6722908-6722930 GATTCAAAGTAGAGGCCCTCTGG + Intergenic
1007120733 6:39378616-39378638 TACCAGAAGGAGTGGCCCTGGGG - Intronic
1007125804 6:39424645-39424667 GATTAGAATGAGATGCCGTCAGG + Intronic
1007844230 6:44740498-44740520 GAGGAGAGGGAGAGGGCCTGGGG + Intergenic
1007897343 6:45376826-45376848 ATTTGGAAGGAGAGGACCTGGGG - Intronic
1009757066 6:67953706-67953728 TATTAGAAGGTGGGGCCCTTAGG + Intergenic
1009758702 6:67976278-67976300 TCTTAGAAAGAGAGGCTCTGGGG - Intergenic
1011347261 6:86384747-86384769 GATGAGAGAGAGAGGCCATGAGG + Intergenic
1012291208 6:97458045-97458067 GAACAGAAGCAGAGGACCTGAGG - Intergenic
1013389813 6:109672969-109672991 GATTAGAAAGAGGGGTCTTGAGG + Intronic
1013524103 6:110958743-110958765 GACTAGAAGGCGAGGCGCCGCGG + Exonic
1017466914 6:154703011-154703033 GATTAGAAGGCCAGGCACAGTGG - Intergenic
1018778034 6:167036409-167036431 AACTAGGAGCAGAGGCCCTGGGG + Intronic
1020632814 7:10660663-10660685 GATTACATGCAGAAGCCCTGAGG + Intergenic
1020711020 7:11605302-11605324 GATTAGAAGCAGTGGACCTATGG - Intronic
1021664877 7:22967166-22967188 GATTAGATTGTGAGTCCCTGTGG - Intronic
1024226893 7:47332259-47332281 GATTACAAGGTGAGGGCCTTCGG + Intronic
1024909252 7:54426607-54426629 GAAAAGAAAGAGAGGCCCTGCGG + Intergenic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028136839 7:87231124-87231146 GATGAGAAGGAGAAGAGCTGTGG + Intergenic
1030209202 7:106979859-106979881 GAGGGGAGGGAGAGGCCCTGAGG - Intergenic
1032934920 7:136717780-136717802 GCACAGAAGCAGAGGCCCTGAGG + Intergenic
1034258178 7:149735878-149735900 TATTAGAAGGAGAGCTCCTCAGG - Intergenic
1035093351 7:156332281-156332303 GATTAGAAGGAGAGTCCTTAAGG + Intergenic
1035551914 8:535183-535205 GAATCTAAGGAGAGGCCTTGGGG - Intronic
1036772697 8:11590012-11590034 TAGTAGATGGAGAGGCTCTGAGG + Intergenic
1037355509 8:18015732-18015754 GATTTGAAAGAGACCCCCTGTGG + Intronic
1037777832 8:21847455-21847477 GCAGAGAAGAAGAGGCCCTGGGG + Intergenic
1037989451 8:23309954-23309976 AATCAGAAGTAGAAGCCCTGGGG - Intronic
1041168044 8:55110959-55110981 GATTAAAAGGAAAATCCCTGAGG + Intronic
1042766445 8:72327201-72327223 GATTAGAAGGAGAGGGACACTGG - Intergenic
1043354292 8:79394515-79394537 GAATTGAATGAGAGTCCCTGGGG - Intergenic
1044136974 8:88598417-88598439 TATTAGAAGGTGGGGCCTTGAGG - Intergenic
1044177965 8:89153336-89153358 GTGTTGAAGGAGAGGCCATGTGG + Intergenic
1046419760 8:113964894-113964916 TATTAGAAGGTGAGGACTTGGGG + Intergenic
1046863763 8:119123481-119123503 CATTAGAAGGTGAGGCCCTTGGG - Intergenic
1046939339 8:119915847-119915869 GATTAGAAAGAGAGCCCTTCTGG - Intronic
1047407919 8:124600823-124600845 GCCTAGAAGGAGCGGCCCAGAGG + Intronic
1048868328 8:138776966-138776988 GATTACACGGTGAGGCACTGGGG + Intronic
1050231366 9:3528528-3528550 GTGTTGAAGGAGGGGCCCTGTGG + Intergenic
1051094168 9:13446228-13446250 GAAGAGAAGTAGAGGCCTTGAGG - Intergenic
1052324423 9:27202139-27202161 GATGAGAAAGAGATGCCTTGAGG - Intronic
1053790258 9:41681597-41681619 GGTAAGTAGGAAAGGCCCTGTGG - Intergenic
1054178604 9:61893298-61893320 GGTAAGTAGGAAAGGCCCTGTGG - Intergenic
1054474672 9:65564283-65564305 GGTAAGTAGGAAAGGCCCTGTGG + Intergenic
1054658929 9:67687531-67687553 GGTAAGTAGGAAAGGCCCTGTGG + Intergenic
1055663896 9:78534221-78534243 TATTAGAAGGTGAGGCCTTTGGG + Intergenic
1057069915 9:92088394-92088416 GATTTGAAAGAGAAGCCCGGAGG - Intronic
1057522132 9:95768546-95768568 TATTAGAAAGAGAGGCCTTTGGG + Intergenic
1058871659 9:109207127-109207149 TATTTGGAGGAGAAGCCCTGTGG - Intronic
1058888198 9:109338930-109338952 GATTCCAAGGACATGCCCTGGGG + Intergenic
1059340912 9:113597129-113597151 GAGTAGAAGGATGGGCCCCGTGG + Exonic
1059436324 9:114278736-114278758 GATTGGAAGGAGAGTCACTTGGG + Intronic
1059692442 9:116698747-116698769 GTTTAGCAGGTGAGGCCCTAGGG - Exonic
1059700209 9:116768608-116768630 TATTAGAAGGTGAGGCCTTTGGG + Intronic
1060841775 9:126799229-126799251 TATTAGAAGGTGGGGCCCTTGGG - Intergenic
1061237672 9:129351976-129351998 GAGAGGAAGGAGAGGACCTGGGG - Intergenic
1061609474 9:131736883-131736905 GATTCAGAGGAGAGGCCCTTAGG - Intronic
1188448810 X:30287000-30287022 GATAAAAAGAAGAGGCACTGGGG + Intergenic
1192547266 X:72024321-72024343 GGCTACCAGGAGAGGCCCTGGGG + Intergenic
1200259249 X:154603440-154603462 GATTACAAGCAAAGGCTCTGAGG + Intergenic
1200980073 Y:9255626-9255648 AAATAGAAGGCCAGGCCCTGTGG + Intergenic