ID: 1002093944

View in Genome Browser
Species Human (GRCh38)
Location 5:176819933-176819955
Sequence CTGGATCAACACTATTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002093939_1002093944 13 Left 1002093939 5:176819897-176819919 CCAGGCACAGCCTGTGGCTCAGA 0: 1
1: 2
2: 2
3: 49
4: 407
Right 1002093944 5:176819933-176819955 CTGGATCAACACTATTTTATTGG 0: 1
1: 0
2: 0
3: 11
4: 120
1002093940_1002093944 3 Left 1002093940 5:176819907-176819929 CCTGTGGCTCAGAAGTAAAGCGG 0: 1
1: 0
2: 0
3: 21
4: 86
Right 1002093944 5:176819933-176819955 CTGGATCAACACTATTTTATTGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002093944 Original CRISPR CTGGATCAACACTATTTTAT TGG Intronic
905801124 1:40843638-40843660 ATGGATCTACACTGATTTATGGG - Intergenic
909717948 1:78732813-78732835 CTGAGTCTACACTATTTTAACGG - Intergenic
910095189 1:83513838-83513860 CTGCTTCAACACTATTTTCCAGG + Intergenic
911004897 1:93209530-93209552 CTGATTCAATACTATTTTATTGG + Intronic
911781266 1:101882523-101882545 CCAGATCAATACTATCTTATAGG - Intronic
912083415 1:105968379-105968401 CTGTATCAACATAATATTATTGG + Intergenic
912208858 1:107536628-107536650 CTGGATGATCACTCTTTTAGAGG - Intergenic
919667818 1:200309464-200309486 GTAGATCATCATTATTTTATGGG + Intergenic
921393399 1:214640819-214640841 GTGAATCAACTCTATTTTGTAGG - Exonic
923419889 1:233802370-233802392 CTGGCTATACTCTATTTTATGGG + Intergenic
1069142925 10:64850659-64850681 TTGGATTAAAACTACTTTATTGG + Intergenic
1071204637 10:83259883-83259905 CTGGATCAATGGTATGTTATGGG + Intergenic
1071832815 10:89389024-89389046 CTGTATGAAAACTATTTTCTTGG - Intronic
1074349234 10:112718667-112718689 CTTGGTCAACACTATTTGCTTGG - Intronic
1075523062 10:123155636-123155658 ACGGTTCAAAACTATTTTATAGG + Exonic
1081748560 11:45490092-45490114 GAGGATCAACTCTATTTAATGGG - Intergenic
1081883887 11:46478109-46478131 TTGGTTAAAAACTATTTTATGGG - Intronic
1087245222 11:95827275-95827297 CTGGATGTACACTGTTTAATAGG + Intronic
1088688265 11:112303422-112303444 TTGGATCACTACTATTGTATAGG - Intergenic
1091336966 11:134778805-134778827 AAGGATCAACAGTATTTCATTGG - Intergenic
1094197715 12:27766892-27766914 CTGGATTAACAGTATTTTTCAGG + Intronic
1097363940 12:58690500-58690522 ATGGATGAACAATATTTGATGGG - Intronic
1097665210 12:62470266-62470288 CTTTATCAATACTCTTTTATTGG - Intronic
1098209409 12:68147763-68147785 CTGTCTCAACACTATTGTGTTGG + Intergenic
1099193028 12:79580522-79580544 CTGTGTCAACACTCTTTCATTGG + Intronic
1100553782 12:95672312-95672334 CTGGATCAGCACCAGTTTGTAGG - Intronic
1107273798 13:38653822-38653844 CTGGACCAACACTATCCAATGGG + Intergenic
1107281380 13:38739319-38739341 CTTGATAAACACAATTTTAATGG + Intronic
1108394228 13:49977721-49977743 CTGGAAAGACACTATTTTAATGG + Intergenic
1109592765 13:64508443-64508465 CTGGATCAAAACCATATTATAGG - Intergenic
1109595026 13:64540388-64540410 CTGGGTCATCACTATCTTTTTGG + Intergenic
1109617170 13:64850674-64850696 CTGTTTTAAGACTATTTTATGGG - Intergenic
1110059357 13:71022080-71022102 CTGGATGCACCCGATTTTATAGG + Intergenic
1111549654 13:89790437-89790459 CTGGATGAACATTATGTAATTGG + Intergenic
1112724340 13:102285221-102285243 CTGGATTAATACAATTTTTTTGG + Intronic
1112868126 13:103933756-103933778 CATGATCTACACTATTTAATTGG + Intergenic
1118919426 14:70136562-70136584 CTGGAAGAACAGTGTTTTATGGG - Intronic
1120470310 14:84915558-84915580 CTGGATCAAAATTATTTTTCTGG + Intergenic
1120745059 14:88145148-88145170 CTGGATCAATCCTATATTGTTGG - Intergenic
1123196001 14:106617305-106617327 CTGGATCTTCTCTATTTTAAAGG - Intergenic
1126425808 15:48525910-48525932 CTGGATCATCCCTCTTTTATGGG + Intronic
1126941728 15:53774328-53774350 CTGGATCAAGAATATGTAATAGG + Intergenic
1138101593 16:54256351-54256373 CTGGGACAACACTAAATTATAGG + Intronic
1140602770 16:76498454-76498476 CTGGATCCATACTCTTTTGTAGG + Intronic
1144606812 17:16673734-16673756 ATGGATCAAGATTATTCTATAGG - Intergenic
1150767417 17:68013161-68013183 CTGGATCATCATTTTTTTGTGGG + Intergenic
1150848362 17:68681519-68681541 CTCTATCAACACTCTTTTCTAGG - Intergenic
1150897449 17:69230067-69230089 ATGGATTAACACTATTATCTTGG + Intronic
1151446700 17:74170874-74170896 ATGGATCTACACTAACTTATGGG + Intergenic
1153718668 18:7878767-7878789 CTGAATCAACACTAATTTAGGGG + Intronic
926865469 2:17352656-17352678 CTTGAAGAACAGTATTTTATCGG + Intergenic
928363395 2:30683663-30683685 CTGGATCAACAATGTTTCAGGGG - Intergenic
928756768 2:34535563-34535585 TTTAATAAACACTATTTTATTGG - Intergenic
928832138 2:35500074-35500096 CTGGATCATCAATCTTTTGTTGG - Intergenic
929026773 2:37612304-37612326 CTGGAAGGATACTATTTTATGGG + Intergenic
933376177 2:81482192-81482214 CTGGAAAAACACCATTTGATTGG + Intergenic
936670404 2:114649678-114649700 TTTGAAAAACACTATTTTATAGG + Intronic
945590708 2:211726773-211726795 GTGAATCAACACTGATTTATAGG - Intronic
945887703 2:215394098-215394120 CAGGGACAAAACTATTTTATAGG + Intronic
948303194 2:236924607-236924629 CTTCATCATCACTATTTTAAAGG + Intergenic
1170029347 20:11928940-11928962 CTGTATCAACACAATTATAAGGG - Intergenic
1170297074 20:14839528-14839550 CATGATAAACATTATTTTATGGG - Intronic
1170344632 20:15370585-15370607 CTGCATCAACCGTATTTTTTTGG - Intronic
1174751742 20:53118065-53118087 CTTGATCACCACTGTTTGATCGG + Intronic
1179835039 21:44025723-44025745 CTTGATGAACACTAATGTATGGG + Intronic
1180913781 22:19471369-19471391 ATGGAGCAACAGTATTTTTTAGG - Intronic
1181411549 22:22725276-22725298 ATGGATCAAGATTATTCTATAGG - Intergenic
949588201 3:5464541-5464563 TTGGATCAAAGCTATTTTAGAGG - Intergenic
949964998 3:9348450-9348472 CTGGATCAACACCAATTTGTAGG - Intronic
951300209 3:20987125-20987147 CTGGATCAGATCTATTTTCTGGG + Intergenic
952002590 3:28803633-28803655 CTGGATCATTTCTAGTTTATGGG + Intergenic
954334772 3:49909823-49909845 CTGGAGCAACTCTACTTTAGGGG - Intronic
963446032 3:145409165-145409187 CTGGGTCAAGACTATTTTGATGG - Intergenic
964721744 3:159773931-159773953 CTTAATCTAGACTATTTTATGGG - Intronic
965313665 3:167163503-167163525 CAGGAGCAATACAATTTTATTGG - Intergenic
971422583 4:26487661-26487683 CTGCATAAAAAATATTTTATTGG - Intronic
972918159 4:43905330-43905352 CTGGATCAACCCTACATTGTCGG - Intergenic
974226502 4:59052149-59052171 CTGTAACAACACTATGTTCTTGG - Intergenic
975083271 4:70306026-70306048 CTTTATCATCACTATTCTATTGG + Intergenic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
977422533 4:96820923-96820945 CTGGAACAGCAATATTTAATGGG + Intergenic
977591497 4:98832458-98832480 CTGGATCAACTATACTTTCTGGG - Intergenic
981098276 4:140803959-140803981 ATGCATCAACAATATTTTCTCGG - Intergenic
981223887 4:142269000-142269022 CTGTATTAAGGCTATTTTATAGG - Intronic
981792865 4:148559810-148559832 ATGCATTAACATTATTTTATAGG + Intergenic
984322885 4:178215463-178215485 CAGGATCAGCACTTTTTTTTAGG + Intergenic
984406800 4:179342917-179342939 CTGCAACAACATGATTTTATAGG + Intergenic
987149369 5:15023278-15023300 ATAGATCAACACTAATTCATGGG - Intergenic
988098151 5:26644324-26644346 CTGGATCAACATTGTTTTTCTGG - Intergenic
988116211 5:26894764-26894786 CTATAACAACAATATTTTATTGG + Intronic
988407886 5:30847718-30847740 CTTGATCAAAACTAATTTACCGG - Intergenic
994155476 5:96498789-96498811 CTGGATTAACACAATTTCAGAGG - Intergenic
995161063 5:108982580-108982602 CTGCATTAACACTATTTTTTCGG + Intronic
996148272 5:120002081-120002103 CTGGATAAATACATTTTTATGGG - Intergenic
996428833 5:123347589-123347611 TTTGATCAACAGTATTCTATTGG - Intronic
998466128 5:142345497-142345519 CTGGATCAAAAGTGTTGTATAGG + Intergenic
1002093944 5:176819933-176819955 CTGGATCAACACTATTTTATTGG + Intronic
1003316355 6:5015762-5015784 CTGGATCAACCCCATTCCATGGG + Intergenic
1004406550 6:15338555-15338577 CTGGATCAATCCTATATTGTCGG - Intronic
1004739927 6:18449011-18449033 CTTGAACATCTCTATTTTATAGG + Intronic
1007909185 6:45496215-45496237 CTGAATCAGCATTATTTTTTAGG - Intronic
1011907940 6:92395823-92395845 CTGCAACTACATTATTTTATTGG + Intergenic
1012716743 6:102683375-102683397 CTGGATCAATCATATTTTATTGG - Intergenic
1016748109 6:147602797-147602819 CTAGAACTACTCTATTTTATTGG - Intronic
1021256890 7:18403339-18403361 TTTGATCAATACTAATTTATTGG + Intronic
1022073755 7:26944970-26944992 CAGGATGAACACAATTCTATTGG + Intronic
1023015164 7:35961316-35961338 CTGGAACAATTCTATTTTAGAGG + Intergenic
1024065783 7:45733376-45733398 CTGGAACAATTCTATTTTAGAGG - Intergenic
1024414886 7:49095511-49095533 TTGGATTAAGAGTATTTTATAGG + Intergenic
1024535868 7:50432175-50432197 GTGGATAAATTCTATTTTATCGG - Intergenic
1027604270 7:80281460-80281482 TTGTATCAAGACTATTTTAGAGG + Intergenic
1030023064 7:105294349-105294371 CTGGATCGACAAAATTTTATTGG - Intronic
1030230191 7:107199889-107199911 CTTTATCAAAACTATTTGATAGG + Intronic
1030781686 7:113609078-113609100 ATGGAGTAACACTCTTTTATAGG + Intergenic
1030917365 7:115332248-115332270 CTGCATCAACTATATTTTACCGG + Intergenic
1033837929 7:145337818-145337840 CTGGATGAACATGATTTTGTGGG + Intergenic
1035234242 7:157485966-157485988 CGGCATCCACACTATTTTAAAGG - Intergenic
1035822941 8:2614369-2614391 CTGGGTCATCCCTATGTTATAGG + Intergenic
1041865227 8:62565152-62565174 TTGGATATACACTATTTTATGGG + Intronic
1045231020 8:100307697-100307719 TTGGGTCACCTCTATTTTATTGG - Intronic
1050233577 9:3555103-3555125 CTGGAAAACCACTATTTTAAAGG - Intergenic
1050443424 9:5690240-5690262 CTATATCAAGACTATTTTCTTGG + Intronic
1051722347 9:20050644-20050666 ATGTATCAACTCTATTTGATAGG + Intergenic
1053248598 9:36555828-36555850 CTGGATCCATACCAATTTATAGG - Intergenic
1059797625 9:117715917-117715939 CTGGATGAACATTCTTTTCTGGG - Exonic
1188334503 X:28913857-28913879 TTTGATTATCACTATTTTATAGG - Intronic
1190516230 X:51225998-51226020 CTTCATCAAGAATATTTTATAGG + Intergenic
1193371536 X:80703899-80703921 CTTGATTATCACTATTTTATTGG - Intronic
1194368532 X:93039658-93039680 TTGGATCTACTCTATTTTCTTGG + Intergenic
1194799474 X:98254215-98254237 CTCTATCAACACTTTTTTATTGG + Intergenic
1194863774 X:99039522-99039544 CTATATAAACACAATTTTATGGG - Intergenic
1198306841 X:135391864-135391886 ATTGATCCACACTATTTTCTTGG + Intergenic