ID: 1002095848

View in Genome Browser
Species Human (GRCh38)
Location 5:176830248-176830270
Sequence CCACCCTGCTTGGGAGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 296}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002095848_1002095856 15 Left 1002095848 5:176830248-176830270 CCAGGAGCTCCCAAGCAGGGTGG 0: 1
1: 0
2: 4
3: 21
4: 296
Right 1002095856 5:176830286-176830308 CTCACAGTGCGCTAAAGCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 103
1002095848_1002095857 19 Left 1002095848 5:176830248-176830270 CCAGGAGCTCCCAAGCAGGGTGG 0: 1
1: 0
2: 4
3: 21
4: 296
Right 1002095857 5:176830290-176830312 CAGTGCGCTAAAGCCTGGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 359
1002095848_1002095855 14 Left 1002095848 5:176830248-176830270 CCAGGAGCTCCCAAGCAGGGTGG 0: 1
1: 0
2: 4
3: 21
4: 296
Right 1002095855 5:176830285-176830307 GCTCACAGTGCGCTAAAGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 67
1002095848_1002095858 22 Left 1002095848 5:176830248-176830270 CCAGGAGCTCCCAAGCAGGGTGG 0: 1
1: 0
2: 4
3: 21
4: 296
Right 1002095858 5:176830293-176830315 TGCGCTAAAGCCTGGGCTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002095848 Original CRISPR CCACCCTGCTTGGGAGCTCC TGG (reversed) Intronic
901324220 1:8357394-8357416 CCACCTTGCTTGGAGGCACCAGG - Intronic
901663731 1:10814918-10814940 CCACCCTCCTTGGGGGCAACTGG - Intergenic
902287321 1:15414918-15414940 CCACCCAGCTGGGTTGCTCCAGG + Intronic
902503087 1:16923366-16923388 GCCCCCTCCTTGGGAGCGCCAGG + Intronic
902572591 1:17356295-17356317 CCACCCTCGTTGGGAGCTCCAGG + Intronic
903215781 1:21842663-21842685 CCAGCCTGCTTGGGGACCCCAGG - Intronic
903328427 1:22584711-22584733 CCACCCAGCCAGGCAGCTCCCGG - Intronic
903851096 1:26306542-26306564 CCAGCCTGCGTGGGGACTCCAGG + Intronic
906196827 1:43934883-43934905 CCACCCTGCTTGGAATCTGCAGG + Intronic
907246955 1:53114719-53114741 ACACCCCGCTTGGGAACGCCAGG - Intronic
907457172 1:54583172-54583194 CCACCCTGGCTGAGAGCTCCTGG + Intronic
912930747 1:113958183-113958205 ACACCCTGCTGGGCAACTCCAGG - Exonic
919661114 1:200248716-200248738 CCTCCCTGCTTCACAGCTCCTGG + Intergenic
919794282 1:201311861-201311883 CCCACCAGCTTGTGAGCTCCTGG + Intronic
921159150 1:212460823-212460845 GCACCCCGCTGGGGAGGTCCAGG - Intergenic
921933899 1:220778347-220778369 CCACCATGATTGGAAGCTTCGGG - Intronic
922215390 1:223516060-223516082 CCACACTGCCTCGGGGCTCCTGG + Intergenic
922452799 1:225750452-225750474 TCTCCCTGCATGGAAGCTCCAGG - Intergenic
922770468 1:228179622-228179644 CTATGCTGCTTGGGAGCTGCTGG - Exonic
922795637 1:228338182-228338204 CGACCCTGCTAGGGGCCTCCGGG - Intronic
923675787 1:236079790-236079812 ACACCCTGCATGGGAACTTCAGG + Intergenic
924024276 1:239816580-239816602 CCACCTTGCTTGGTACTTCCTGG - Intronic
924216346 1:241826344-241826366 CCACCATGATTGGAAGCTTCCGG - Intergenic
1062984495 10:1755098-1755120 CTGCCCTGCTTGGGAGAACCTGG + Intergenic
1063092212 10:2875232-2875254 CCACCCTGCTTGGGACCTGATGG - Intergenic
1067145829 10:43693122-43693144 CCACTCTGCTGGGCAGCACCAGG - Intergenic
1067805971 10:49394123-49394145 CCACCCTGCATGGGAACTTGGGG + Intronic
1068955995 10:62818886-62818908 CCACCCCGAGGGGGAGCTCCTGG + Intronic
1070420319 10:76229801-76229823 ACACCCAGGTTGGGTGCTCCTGG - Intronic
1070833621 10:79434962-79434984 CCACCCAGCCTTGGAGCACCTGG + Intronic
1071639802 10:87295303-87295325 CCACCCAGCTAAGAAGCTCCTGG - Intergenic
1071655432 10:87442649-87442671 CCACCCAGCTAAGAAGCTCCTGG + Intergenic
1071758101 10:88568586-88568608 CTTCCCTGCTTGGGACCTCTTGG - Intronic
1074768901 10:116720549-116720571 CCATCCTGCTGGGGTGCTGCAGG + Intronic
1075021596 10:118956437-118956459 CAAGCCTGCTGGGGACCTCCAGG + Intergenic
1075893904 10:125978264-125978286 AGACCCTGGTTGGGAGGTCCCGG + Intronic
1076413155 10:130265869-130265891 CCTCCCTCCTCTGGAGCTCCCGG - Intergenic
1077444255 11:2583033-2583055 CCAGCCTCAGTGGGAGCTCCCGG + Intronic
1077608962 11:3632250-3632272 CCAGCCTGCTTTGTGGCTCCTGG + Intergenic
1078143669 11:8709011-8709033 GCAGCCTGCATGGGGGCTCCGGG - Intronic
1078527470 11:12111359-12111381 ACACCCTGCGGGGGTGCTCCTGG - Intronic
1079350302 11:19686311-19686333 CCTCCCAGACTGGGAGCTCCAGG + Intronic
1079383683 11:19960280-19960302 CCATCCTACTCTGGAGCTCCGGG + Intronic
1081702056 11:45158377-45158399 CCAGCCTGTCTGGGAGCTGCAGG - Intronic
1081807440 11:45898205-45898227 CCACCCCACTCAGGAGCTCCTGG - Intronic
1083594118 11:63910908-63910930 CCACCTTGCCTGGGTGCCCCGGG - Exonic
1084423802 11:69073440-69073462 CCACACTGCCTGTGAGCACCTGG - Intronic
1084579887 11:70016608-70016630 CCGTCAGGCTTGGGAGCTCCTGG + Intergenic
1084734438 11:71095182-71095204 TTACCCAGATTGGGAGCTCCAGG - Intronic
1088829126 11:113520359-113520381 CCACCCTGATCGGGAACTTCAGG + Intergenic
1089116952 11:116103123-116103145 CCACTCTTCTCGGGAGCTCCTGG + Intergenic
1090040566 11:123287381-123287403 CCACCCAGCTAAGCAGCTCCTGG - Intergenic
1090876036 11:130789737-130789759 CCACCCTGCATGGGGTCACCTGG + Intergenic
1091241450 11:134055115-134055137 CGACCCTGCGGGGGAGCTCTGGG + Intergenic
1091428437 12:411864-411886 CCATCCTTCTAAGGAGCTCCTGG + Exonic
1091445665 12:543104-543126 CCTTCCTGCATGGGAGGTCCAGG + Intronic
1091476088 12:774255-774277 TCACCCTCCTTGGGAGCTGCAGG - Intronic
1091568897 12:1667459-1667481 CCAGCCTGGTCGTGAGCTCCTGG - Intergenic
1092029641 12:5273719-5273741 CCACCCTCCCAGGGGGCTCCTGG - Intergenic
1096145497 12:49276077-49276099 GCACCCTGCTTGGGAAATGCTGG - Intergenic
1096514433 12:52148294-52148316 CCTCCCTACTTGGGGGATCCAGG + Intergenic
1097076335 12:56397421-56397443 CCTGCATGCTTGGGAGCCCCAGG - Intergenic
1101154466 12:101914865-101914887 CCAGGCTGGTTTGGAGCTCCTGG + Intronic
1103405248 12:120670413-120670435 CTTCCCTGCTGGGGAGCTCTGGG + Intergenic
1103743633 12:123107674-123107696 GCACCCTGCTTGGGAGTTTGTGG - Intronic
1104753689 12:131255729-131255751 CCATCCTGCTGTGGAGGTCCAGG - Intergenic
1104893723 12:132151994-132152016 CCACTCTGGTTGGGAGCACAGGG + Intronic
1105354214 13:19643765-19643787 CTACCCTGAGTGGGAGCGCCAGG - Intronic
1106327337 13:28706619-28706641 CCACACTGCTTTTGAACTCCTGG + Intronic
1111792769 13:92879531-92879553 CCACCCAGCTGTGGAGCTGCTGG - Intergenic
1112578954 13:100662163-100662185 GTACCCTGCTGGGGAGCTGCTGG + Intronic
1112578979 13:100662275-100662297 GCACTCTGCTGGGGAGCTGCTGG - Intronic
1113664529 13:112132011-112132033 CCTCCCTGCGTGAGAGCTGCCGG - Intergenic
1113821176 13:113214560-113214582 CCAGGCTCCTTGGGAACTCCTGG + Intronic
1114613360 14:24056033-24056055 CCACCCTGCTTGGTAGTTAATGG - Intronic
1114636361 14:24189013-24189035 CAACCCAGCTTGGGAACTCCCGG - Exonic
1116207056 14:41882154-41882176 CCACCCTGCTTTACAGCTCTGGG + Intronic
1117452642 14:55865815-55865837 CCTCCCTGAGAGGGAGCTCCCGG - Intergenic
1118234844 14:63992917-63992939 CCACCCTGCTTAGCTTCTCCCGG + Intronic
1118752949 14:68819677-68819699 CCTCCCAGAGTGGGAGCTCCAGG + Intergenic
1119253053 14:73173938-73173960 CCAAGCTGCTTGTGAACTCCTGG - Intronic
1119389421 14:74280996-74281018 TCACCCTGCTTGGAGGCTCAAGG + Intergenic
1120392201 14:83923755-83923777 CCTGCCTGGTTGGGATCTCCTGG + Intergenic
1121885464 14:97538840-97538862 CCACCCTGCTTGAAATGTCCTGG + Intergenic
1122068453 14:99189807-99189829 CCACACTGTGTGGGAGCACCTGG + Intronic
1122569237 14:102683582-102683604 CCACATTGCTTGGGACCCCCGGG - Intronic
1122574378 14:102732456-102732478 GCACGGTGCTTGGGAGCTGCAGG - Intergenic
1122843316 14:104477179-104477201 CTGCCCAGCCTGGGAGCTCCAGG - Intronic
1122929747 14:104927810-104927832 CAGCCCAGCTTGGGAGCCCCTGG + Exonic
1125526503 15:40379200-40379222 CCAGGCTGGTCGGGAGCTCCTGG - Intergenic
1126167819 15:45668497-45668519 ACACTATGCTGGGGAGCTCCTGG + Intronic
1129255722 15:74332958-74332980 CCAGTCTGCCTGGGGGCTCCTGG + Intronic
1129899928 15:79139171-79139193 CCAGCCTGGTTTTGAGCTCCTGG + Intergenic
1130128526 15:81115895-81115917 CCAGGCTGATTGCGAGCTCCTGG + Intronic
1132204146 15:99975024-99975046 CCGGCCTGCTTGGGAACTTCAGG - Intronic
1132500365 16:282220-282242 ACACCCTACGTGGGGGCTCCTGG + Intronic
1132638673 16:966995-967017 CCACCCTGGGTGGGTTCTCCTGG - Intronic
1132690214 16:1178731-1178753 CCAACCTGCCCAGGAGCTCCTGG - Intronic
1133076451 16:3284100-3284122 GCACCCTGCTCTGGATCTCCTGG - Exonic
1133214938 16:4286339-4286361 CCAGGCTGGTTGGGAGCTGCTGG + Intergenic
1134508944 16:14830857-14830879 CCAAGCTGCTTTGGAACTCCTGG + Intronic
1134537782 16:15040577-15040599 CCTCCCTGCTTGGCAGCCCCAGG - Intronic
1134614509 16:15640492-15640514 CCAGGCTGGTTGGGAACTCCTGG - Intronic
1134696645 16:16229691-16229713 CCAAGCTGCTTTGGAACTCCTGG + Intergenic
1134975188 16:18565014-18565036 CCAAGCTGCTTTGGAACTCCTGG - Intergenic
1137368164 16:47878794-47878816 CAACCCTGCTCAGGACCTCCAGG - Intergenic
1137559280 16:49492595-49492617 CGACCCTTCCTGCGAGCTCCCGG + Intronic
1138491549 16:57380004-57380026 CCACCCTTCATGGCTGCTCCAGG - Intronic
1139345457 16:66300273-66300295 CCACCCTTGTTGGGGACTCCTGG - Intergenic
1139418707 16:66834825-66834847 CCAGCCTGGTTTCGAGCTCCTGG - Intronic
1139631635 16:68235213-68235235 TCGGCCTGCTTGGGAGCTGCTGG - Intronic
1139690510 16:68638736-68638758 CCACCATGATTGGAAGCTTCTGG - Intronic
1141146307 16:81532682-81532704 CCACCTTCCTTGGAGGCTCCTGG - Intronic
1141435471 16:83997361-83997383 TCTCCCTGCTTGGGACCACCAGG + Intronic
1141627925 16:85271220-85271242 CGATCCTGCTTGGGGGCTCTGGG - Intergenic
1142215521 16:88827877-88827899 CGACACTGGGTGGGAGCTCCAGG - Intronic
1142273076 16:89101137-89101159 CCACCGGGCTCAGGAGCTCCAGG - Exonic
1142474677 17:181693-181715 TCACCCTGCTTGGTTGCTGCCGG - Intergenic
1142749783 17:1980278-1980300 CCAGCCTGGTTTGGAACTCCTGG + Intronic
1143116869 17:4585917-4585939 CCACCCTGGATGGGACCTCCAGG - Intronic
1144775048 17:17781168-17781190 CCACCAAGCTAGGCAGCTCCTGG + Intronic
1145767904 17:27471991-27472013 CCGGCCTGCTTGGGGGCACCTGG + Exonic
1145775150 17:27522558-27522580 GCAGCCTGCCTGAGAGCTCCAGG + Intronic
1146575897 17:33991324-33991346 TCACCCTGCTGGGGAGAGCCAGG + Intronic
1147138432 17:38448162-38448184 CCTCCCTGCTTGGGAGGAACTGG + Intronic
1148229345 17:45921542-45921564 CCACCCTGCATGGGGGCACCGGG - Intronic
1148683320 17:49486896-49486918 CCACACTACTGGGGAGCCCCAGG - Intergenic
1149025223 17:52019038-52019060 CCACCATGATTGGAAGCTTCTGG + Intronic
1149522067 17:57324892-57324914 CCAACCTGCTTGTGAGCTGGAGG + Intronic
1150286524 17:63957512-63957534 CCTCCCTGCTTGGCAGCTGCGGG - Exonic
1151213450 17:72561513-72561535 CCACACTCCCTGTGAGCTCCGGG - Intergenic
1151573183 17:74937443-74937465 CTACCCTGCTTGGGGGCTGGAGG + Intronic
1151664934 17:75540402-75540424 CCACCCTGCCTTGGTCCTCCTGG + Intronic
1151817662 17:76479132-76479154 CCTCCTGGCTGGGGAGCTCCAGG + Exonic
1151975316 17:77480908-77480930 CCAGCCTGCGTGGGAGCTGAGGG + Intronic
1152400371 17:80062798-80062820 CCAGACTGGTTGGGAACTCCTGG + Intronic
1152557216 17:81059365-81059387 GCAGCCTGCCTTGGAGCTCCTGG + Intronic
1152943826 17:83187269-83187291 CCAGACTGCTGGGGAGCACCTGG + Intergenic
1154478735 18:14795404-14795426 CCAGGCTGCTTTGGAACTCCTGG + Intronic
1154479688 18:14807739-14807761 CCAGGCTGCTTTGGAACTCCTGG + Intronic
1154480769 18:14821665-14821687 CCAGGCTGCTTTGGAACTCCTGG + Intronic
1155057526 18:22197963-22197985 CCACAAAGCCTGGGAGCTCCTGG + Intronic
1160135243 18:76266052-76266074 CCGCCCTGCCTGAGAGCTGCTGG - Intergenic
1161051620 19:2166872-2166894 TCAGCTTGCCTGGGAGCTCCTGG + Intronic
1161381203 19:3965992-3966014 CCAGGCTGCTTTGGAACTCCTGG + Intronic
1161637897 19:5400729-5400751 CCTCTCTGCTTGGAAACTCCTGG - Intergenic
1163684018 19:18700379-18700401 CCACGGTGCTTGGGGGCTCTCGG + Intronic
1163805374 19:19393652-19393674 CTACCCTCATTGGGAGCTTCAGG + Intronic
1164492406 19:28727372-28727394 CCACCCAGGTGGGGAGCCCCTGG + Intergenic
1164788429 19:30956313-30956335 CCACCCTACTTGGGGTCGCCTGG + Intergenic
1165108972 19:33490189-33490211 CCACCCAGCCAGGTAGCTCCAGG + Intronic
1165144911 19:33724749-33724771 CCACCTGGCTGGGGAGCTCCAGG - Intronic
1165204003 19:34168551-34168573 CTTCCCTGCTTAAGAGCTCCCGG + Intergenic
1165795590 19:38517360-38517382 CCACACTGTTGGGGAGCCCCAGG - Exonic
1166160645 19:40950313-40950335 CCAGGCTGGTTGTGAGCTCCTGG + Intergenic
1167023189 19:46894192-46894214 CCACACTACTTGGAAGCTCATGG + Intergenic
1167471354 19:49677834-49677856 CCAACCTCCTTCCGAGCTCCGGG + Intronic
1167656725 19:50769574-50769596 CCACCTTGGTTTGGAACTCCTGG + Intergenic
1167899890 19:52612123-52612145 CCACACTGCTTGGGAGACCGAGG - Intronic
1167924182 19:52810048-52810070 GCCCCATGCCTGGGAGCTCCAGG + Intronic
925635750 2:5940412-5940434 CAGCCCAGCTTTGGAGCTCCAGG + Intergenic
925913159 2:8586544-8586566 GCCCCCTGCTTGGGAGCTCCTGG - Intergenic
929053964 2:37860123-37860145 CCCTCCAGCCTGGGAGCTCCTGG + Intergenic
929757425 2:44779068-44779090 TCCCCCTCCTTGAGAGCTCCGGG + Intergenic
930881150 2:56271970-56271992 ACACCCTGATTGGGAGCTAAAGG + Intronic
931695971 2:64870884-64870906 CCACCAGGCTTGGGAGCCACTGG - Intergenic
932073434 2:68643342-68643364 CCGCCCTGCATGGGTGCCCCCGG + Intergenic
932476351 2:72008761-72008783 CCTCACTGCTCGGGAGCACCAGG + Intergenic
932803537 2:74764098-74764120 CCTCCCTGCTGGGTAGCTCTGGG - Intergenic
932803571 2:74764259-74764281 CCTCCCTGCTGGGTAGCTCTGGG - Intergenic
933639299 2:84741906-84741928 AAACCCTGTTTTGGAGCTCCAGG + Intronic
934729533 2:96647898-96647920 CCACCCTGCCTGGGCCTTCCTGG - Intergenic
934746515 2:96762991-96763013 GCTCCCAGCTTGGGAGCTACAGG + Intronic
934922390 2:98356092-98356114 CCATCCTGCTTGAGAACTGCAGG - Intronic
935631661 2:105217134-105217156 CCACCCTTCCTGGGAGCTCCAGG - Intergenic
935746005 2:106190894-106190916 CCAACCTACTAGGTAGCTCCTGG - Intronic
937972838 2:127564038-127564060 CCAGCCACCTTGGGAGCTCTGGG + Intronic
939997432 2:148932846-148932868 CTGCCCTGCTTGGGAGGTCAAGG + Intronic
942225694 2:173813679-173813701 GCACCCTGCTCGGGATTTCCTGG + Intergenic
944234599 2:197430567-197430589 CCCACCTGCTTGGGAGCCTCAGG - Intronic
944593795 2:201243712-201243734 CCACCCTGTTTTGGAGGGCCTGG + Intronic
944707868 2:202309221-202309243 CCAGGCTGGTTTGGAGCTCCTGG - Intergenic
945213385 2:207407527-207407549 CATCCCTGCTTGGTAGCTTCCGG - Intergenic
947261175 2:228224044-228224066 CCACATTGCTTGGGAGCCTCAGG - Intergenic
947773926 2:232692780-232692802 CCACACTGGTCGGGAACTCCTGG + Intergenic
948738952 2:240030431-240030453 CCTCTGTGCTTGGGAGCTGCAGG + Exonic
948740685 2:240043889-240043911 CCACCATGCCTGGGAGCTCTCGG + Intergenic
948741027 2:240046074-240046096 CCTCTGTGCTTGGGAGCTGCAGG + Intergenic
948939677 2:241189564-241189586 CCGCCTTGCTGGGGAGCTCAGGG + Intronic
949030918 2:241796904-241796926 TCACCCTGCATGGGACCTCAAGG - Intronic
1169162684 20:3395488-3395510 CCAGCCTGCTTTTGAACTCCTGG + Intronic
1170763231 20:19270046-19270068 CCAGCCTGATTGGGAGTCCCTGG + Intronic
1171145755 20:22780730-22780752 CAACCCTGCTAGGGAGGTCAGGG - Intergenic
1172774237 20:37397895-37397917 CCACCCCGTGTGGCAGCTCCGGG + Intronic
1172888806 20:38249289-38249311 CCAGCCTGGTTGCAAGCTCCAGG + Intronic
1173000192 20:39099857-39099879 CCTACCTGCTTGGGGGCTCCAGG - Intergenic
1173656995 20:44706335-44706357 CCAGCCTGCTGGGGAGCTGGAGG - Intergenic
1174426245 20:50433415-50433437 CCCACCAGATTGGGAGCTCCAGG - Intergenic
1174462193 20:50690997-50691019 CCTCCGGCCTTGGGAGCTCCAGG + Intronic
1175979339 20:62729222-62729244 CCTCCCAACTTGGGGGCTCCGGG + Intronic
1176121754 20:63457281-63457303 CCACCCTCATTCGGAGCTTCCGG + Intronic
1176145155 20:63562221-63562243 CCACCCTGCATGAGTGCTCAGGG - Intronic
1176172789 20:63703692-63703714 CCACCCTGCTCAGAAGCCCCAGG - Intronic
1176799782 21:13414585-13414607 CCAGGCTGCTTTGGAACTCCTGG - Intergenic
1176800853 21:13428565-13428587 CCAGGCTGCTTTGGAACTCCTGG - Intergenic
1177496096 21:21894463-21894485 CCACCCTGCTTAGCAGTTCAAGG - Intergenic
1178737178 21:35162760-35162782 CTACCCTGCTTGGGAACACTAGG - Intronic
1181233994 22:21438820-21438842 CCACCCAGCTGGGGAGCAGCCGG + Intronic
1181244654 22:21496011-21496033 CCACCCAGCTGGGGAGCAGCCGG - Intergenic
1181308563 22:21931056-21931078 CCACCCAGCCTGGGAACTTCAGG - Intronic
1183302776 22:37066425-37066447 CCAGCCAGCCTGGGACCTCCTGG + Intronic
1183335860 22:37245392-37245414 GCACCCTCCTTTGGAGTTCCTGG - Intergenic
1183676608 22:39302331-39302353 CAACCCTGCTTCTGAGCTGCTGG + Intergenic
1183715129 22:39528989-39529011 CCAGCGTGCTTCTGAGCTCCGGG - Intergenic
1184038346 22:41929015-41929037 CCTTCCTGCCTGGGAGCTGCTGG - Intergenic
1184253726 22:43275512-43275534 CTGCCCTTCTTGGGAGCTCATGG + Intronic
1184370536 22:44079149-44079171 CCAGCCTGCTGGTGTGCTCCTGG + Intronic
950200017 3:11036098-11036120 TCTCCCTGAATGGGAGCTCCAGG - Intronic
950872014 3:16237742-16237764 CCACTCTCCTTGGGAGGCCCTGG + Intergenic
952943180 3:38458628-38458650 CCCCTCTGCTTGGGAGCTCAGGG + Intronic
953660521 3:44888256-44888278 CCACCCTTTTTGGGAGCACTGGG + Intronic
954348860 3:50025632-50025654 CCAGGCTGGTTGGGAACTCCTGG + Intronic
954370095 3:50165788-50165810 CCAGCCTGCTGGGCAGCCCCAGG + Intronic
954700255 3:52447115-52447137 CCCCCCTGCTTGCCAGCTGCAGG + Intergenic
954875944 3:53803319-53803341 CAACCCTGCCCGGGTGCTCCTGG - Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
960121445 3:113951490-113951512 GCACCCTCCATGGCAGCTCCAGG - Intronic
960673646 3:120174990-120175012 CCATCCTACTTGGGAGCTACTGG + Intronic
960960529 3:123067441-123067463 GCACCCTGCCAGGGATCTCCCGG - Intronic
960971621 3:123143912-123143934 CAACACTGCCTGGGAGCTCAAGG + Intronic
961592002 3:127988244-127988266 CCACCCTGCTTAGTGGCTCTGGG - Intergenic
961649219 3:128409094-128409116 CCACCCTGCCTTGTAGCCCCAGG + Intergenic
961743150 3:129046452-129046474 CCACCTTGCGCGTGAGCTCCAGG - Intergenic
962452491 3:135532183-135532205 CCAGCCTGATTGGGAGCTGCTGG + Intergenic
963900094 3:150725581-150725603 CCAGTCTGCTGGGGTGCTCCTGG + Intergenic
964663746 3:159150300-159150322 TCACCCTGCAGGGGAGCTCTGGG + Intronic
965498344 3:169426495-169426517 CCACCATGTTTGGATGCTCCAGG - Intronic
967196524 3:187031050-187031072 CCAACCAGATTGAGAGCTCCTGG - Intronic
968913673 4:3487977-3487999 CCACACGGCTTAGCAGCTCCTGG - Intronic
970901912 4:21169359-21169381 CCAGGCTGGTTTGGAGCTCCTGG + Intronic
976659856 4:87529322-87529344 CCAGCCTGCTAGGGAAATCCAGG - Exonic
980341910 4:131561400-131561422 CCACCCTGGTCTGGAACTCCTGG + Intergenic
983290622 4:165799426-165799448 ACACCCTGCTCCGTAGCTCCTGG - Intergenic
985564133 5:606811-606833 CCACCCTGCCTGGGGGCTCCTGG + Intergenic
989523073 5:42423722-42423744 GCGCCCTGCTTGGCAGCTCGCGG - Intergenic
991704581 5:69346084-69346106 CCAGCCTGGTCGGGAACTCCTGG - Intergenic
992113223 5:73515553-73515575 CCAGGCTGCTTTTGAGCTCCTGG + Intergenic
992231714 5:74670587-74670609 CCACCCTGGCTGGCAGCTCTGGG - Intronic
996874473 5:128226050-128226072 TCACCTTGCTAGGGAGCTCCAGG - Intergenic
997381907 5:133444389-133444411 CCACCCTGCCTGGCAGTGCCCGG + Intronic
998236526 5:140402554-140402576 CCACCCTGCTTTGGAGTTGGGGG + Intronic
1001556050 5:172637929-172637951 CAGCCCTGCTTGGGAGCTAGTGG + Intergenic
1001994918 5:176149369-176149391 CCACCAGGCATGGGAGCCCCAGG + Intergenic
1002090092 5:176799211-176799233 CCACCCTGCTTGGGTCTCCCAGG + Intergenic
1002095848 5:176830248-176830270 CCACCCTGCTTGGGAGCTCCTGG - Intronic
1003592259 6:7446053-7446075 CCACCCTGCACGGCACCTCCTGG + Intergenic
1006439727 6:34046534-34046556 CCGTCCTGCTGGGGACCTCCAGG + Intronic
1006578526 6:35063138-35063160 CCACCATCCTAGGGAGCACCTGG - Intronic
1006923488 6:37641096-37641118 CCACTCTGCCTGGCAGCTCTGGG + Intronic
1008626984 6:53326518-53326540 TTTCCCTGCTTGGGAGCTGCCGG - Intronic
1017032778 6:150238646-150238668 CCAGCTGGCCTGGGAGCTCCTGG + Intronic
1017709878 6:157157811-157157833 CCAGGCTGCTTGTGAACTCCTGG - Intronic
1018913498 6:168118100-168118122 CCACCCAGCTTGGTGGCTCCAGG - Intergenic
1019433631 7:1010952-1010974 CCTCCCTTCCTGGAAGCTCCCGG - Intronic
1019462628 7:1169033-1169055 CCAGCCTGGTTTGGAACTCCTGG + Intergenic
1020567342 7:9814503-9814525 ACACCCTGCTTGCAAGCTGCTGG - Intergenic
1023086063 7:36571242-36571264 CCACCCAGCTGGGGAGACCCAGG - Intronic
1023879094 7:44308487-44308509 CTTCCCTGATTGGGAGCTGCTGG + Intronic
1024107595 7:46108669-46108691 CCATCCCTCTAGGGAGCTCCTGG + Intergenic
1026011424 7:66639271-66639293 CCACCTTGCTTGGTGGCTCTGGG + Exonic
1026243160 7:68594832-68594854 CCACCTAGGTTGGGAGCTCAGGG - Intergenic
1026500384 7:70938584-70938606 CCACCATGATTGGAAGCTTCTGG + Intergenic
1026536337 7:71241676-71241698 CCAAGCTGGTTGGGAACTCCTGG - Intronic
1026791469 7:73335272-73335294 CAAAGCTGATTGGGAGCTCCAGG + Intronic
1026968573 7:74454663-74454685 CCACCCTGCTGGGGCAATCCTGG - Intronic
1027264668 7:76487781-76487803 CCACTCTGTCTGGGATCTCCTGG + Intronic
1027316040 7:76985883-76985905 CCACTCTGTCTGGGATCTCCTGG + Intergenic
1027416823 7:77982904-77982926 CCACCCTTCTTAGGAGCCTCAGG + Intergenic
1028656415 7:93213086-93213108 CCGCCCTGCTTGGGAGCAGATGG + Intronic
1030829521 7:114203629-114203651 CCACCATGCCTGGCAGCACCTGG + Intronic
1033120327 7:138662421-138662443 CCAACCTACTTGGGTGCTCTGGG + Intronic
1034675191 7:152887900-152887922 ACACCCTCAGTGGGAGCTCCTGG + Intergenic
1035038001 7:155907958-155907980 CCCCTCTGCTTTGCAGCTCCTGG + Intergenic
1035315102 7:157992718-157992740 CCACGGTGCCTGGGGGCTCCTGG - Intronic
1035589137 8:799804-799826 CCAGGCTGATTGCGAGCTCCTGG + Intergenic
1037313463 8:17579353-17579375 CCACTCTCCTTAGTAGCTCCTGG - Intronic
1037427152 8:18768353-18768375 CCACACTGCCTGGGAGGCCCAGG + Intronic
1037481845 8:19313296-19313318 TCACTCTGCTTGGGTGCTGCAGG - Intergenic
1037886418 8:22598675-22598697 CCACACTGCTAGGGAGCGCCGGG + Intronic
1040292653 8:46133325-46133347 CCAGCCTGCCTGGGAACCCCTGG + Intergenic
1040455494 8:47593809-47593831 CCACCCTGGCTGGGAGGGCCAGG + Intronic
1041425287 8:57713940-57713962 CCACCATGCTTGGGGCTTCCTGG - Intergenic
1046295863 8:112218415-112218437 CCACCAAGCTTGAGAGTTCCAGG - Intergenic
1048250414 8:132862453-132862475 CCACCCTGCCTGGGAGGGTCAGG + Intergenic
1048591789 8:135827120-135827142 CCACCCAGCTGGTGAGCCCCAGG - Intergenic
1048971295 8:139646224-139646246 TCACCCTTCTTTGGAGCTCATGG + Intronic
1049247617 8:141571226-141571248 CCACCCCACTGGGGAGCCCCTGG - Intergenic
1049595514 8:143481534-143481556 CCTCCCTGCTGTGGAGCCCCTGG - Intronic
1049716965 8:144097604-144097626 CCACACTGCATGGGACATCCTGG - Intergenic
1050417821 9:5434103-5434125 CCACCCTGTCTGGGAGGTCAGGG + Intronic
1052862467 9:33445550-33445572 CTGCCCTGCTTGGGAGGCCCTGG + Intronic
1053099016 9:35353630-35353652 CTGCCCTGCTTGGGAGATCCAGG - Intronic
1053415051 9:37942160-37942182 CCAACCTCCTTCGGAGCTACAGG + Intronic
1056629713 9:88283162-88283184 CCACCCTGCTGAGAAGCTGCTGG + Intergenic
1057873187 9:98733371-98733393 CCACCCTGCAGGAGAGCTCAGGG + Exonic
1059099808 9:111459298-111459320 CCAGGCTGCTTGTGAACTCCTGG + Intronic
1060887668 9:127167104-127167126 CCACCCTTCTTTGGTGCTTCCGG - Intronic
1061013346 9:127968125-127968147 ACACCCTGGTTGGGACATCCAGG + Intronic
1061272862 9:129553483-129553505 TCACCCTGCTTGGGAGAGGCAGG - Intergenic
1062243947 9:135553786-135553808 CCACCTTGCCAGGGTGCTCCGGG + Intergenic
1062261998 9:135667474-135667496 CCACCTCCATTGGGAGCTCCAGG + Intergenic
1062386694 9:136314928-136314950 TGACCCTGCTGGGGAGATCCTGG - Intergenic
1062415199 9:136445451-136445473 CAAAACTGTTTGGGAGCTCCAGG - Intronic
1186878464 X:13840389-13840411 CCTCCCTGCCTGCGGGCTCCGGG + Intronic
1189271227 X:39753434-39753456 CCACCCGGTTGGGGAACTCCAGG - Intergenic
1190280091 X:48923666-48923688 CTACCCTGCTTTGGAGTGCCGGG - Exonic
1190496761 X:51033996-51034018 TCATCCTGCTTGGGGTCTCCAGG + Intergenic
1190580032 X:51883370-51883392 CCACTCTGCTTGGGAGAGACTGG - Intronic
1190918316 X:54826397-54826419 TCACGGTGCTTGGGAGTTCCTGG - Intergenic
1192885825 X:75335241-75335263 CCACCCTGCCTGGGAGGTGAGGG - Intergenic
1199746482 X:150774948-150774970 CCACCCTGCTTGAGATCCCACGG - Intronic
1199791617 X:151160825-151160847 CCAGCCTTCTAGGGAGCTCCTGG - Intergenic