ID: 1002095880

View in Genome Browser
Species Human (GRCh38)
Location 5:176830540-176830562
Sequence GTGTGCATGTGCATGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1044
Summary {0: 1, 1: 3, 2: 15, 3: 143, 4: 882}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002095880 Original CRISPR GTGTGCATGTGCATGTGTCC TGG Intronic
900009952 1:97049-97071 GCATGCATGTGCATGTGTGTTGG + Intergenic
900026064 1:273633-273655 GCATGCATGTGCATGTGTGTTGG + Intergenic
900035848 1:407488-407510 GCATGCATGTGCATGTGTGTTGG + Intergenic
900057469 1:643238-643260 GCATGCATGTGCATGTGTGTTGG + Intergenic
900078773 1:839318-839340 GTGTCCAGGTGTGTGTGTCCAGG - Intergenic
900187899 1:1341202-1341224 GTGTGCGTGTGCGTGTGTGCAGG - Intronic
900197907 1:1386435-1386457 GTGTGCTTGTGAAAGTGTCCAGG - Intronic
900215465 1:1479261-1479283 GTGTGCCTGTACACGTGTGCTGG - Intronic
900222726 1:1517928-1517950 GTGTGCCTGTACACGTGTGCTGG - Intronic
900222827 1:1518481-1518503 GTGTGCGTGCCCATGTGTGCGGG - Intronic
900561025 1:3306482-3306504 GTGTCCACGTGGCTGTGTCCAGG - Intronic
900754963 1:4427535-4427557 GTGTGCGTGTGTGTGTGTCTTGG + Intergenic
900940336 1:5794428-5794450 GTGTGTGTGTGCACGTGTGCAGG - Intergenic
900953023 1:5869006-5869028 GTGTGCATGTGTGTGTGTATGGG - Intronic
901160746 1:7175064-7175086 GTGTGTATGTGCGTGTCTGCAGG + Intronic
901474165 1:9477760-9477782 GTATGCATGTGTATGTGTGTGGG - Intergenic
901804608 1:11730281-11730303 GTGTGCATGGGCATGTGCATGGG - Intergenic
901804612 1:11730303-11730325 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
901804615 1:11730343-11730365 GTGTGCATGGGCATGTGCATGGG - Intergenic
901804619 1:11730365-11730387 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
902511927 1:16971401-16971423 GTGTGTGTGTGCATGTGTGACGG - Intronic
902538368 1:17135051-17135073 GTGTGTATGTGCATGTGGGTGGG - Intergenic
902785335 1:18729478-18729500 GTGTGCATGTGTAAGTGTATTGG + Intronic
903258691 1:22119579-22119601 GAGTCCATGTGTATGTGTGCTGG + Exonic
904036766 1:27563177-27563199 GTGTGCATGTGTGTGTGTCTTGG - Intronic
904036772 1:27563291-27563313 GTGTGCATGTGTGTGTGTCTTGG - Intronic
904254979 1:29249177-29249199 GTGTGCGTGTGAGTGTGTGCAGG - Intronic
904536034 1:31199986-31200008 GTGTGCGTGTGTGTGTGTTCGGG - Intronic
904813174 1:33177022-33177044 GTGTGCATGTGTATGTGTGTTGG - Intronic
905296010 1:36954908-36954930 GTGTGAACGTGCATGTGCACAGG - Intronic
905347181 1:37319105-37319127 GTGTGCGTGTGTATGGGTCTGGG + Intergenic
905347199 1:37319212-37319234 GTGTGCGTGTGTATGTGTCTGGG + Intergenic
905392888 1:37649392-37649414 GTGTGTGTGTGCAGCTGTCCTGG - Intergenic
905530246 1:38672688-38672710 TTTTGCAAGTGTATGTGTCCAGG + Intergenic
905685049 1:39901872-39901894 GCGCGCATGTGCGTGTGTGCTGG - Exonic
907569048 1:55466222-55466244 GTGTGGAAGTGCAGGTGGCCAGG + Intergenic
907836457 1:58113562-58113584 GTGGGCATGTGTTTGTGTACTGG + Intronic
907975724 1:59429647-59429669 GGATGCATATGCATGTGTGCTGG - Intronic
908031915 1:60009621-60009643 GTGTGCGTGTGTGTGTGTCCGGG - Intronic
909106474 1:71415902-71415924 GTGTGTATGTGGATGTGTGTGGG + Intronic
909513202 1:76478116-76478138 CTGTGCATGTTCATGAGACCTGG - Intronic
909961583 1:81851758-81851780 GTGTGTATGTGTATGTATTCTGG + Intronic
909970196 1:81975068-81975090 GTGTGCAGGTGTGTGTGTACAGG - Intronic
910123436 1:83815384-83815406 GTTGGCATGTGCATGTGTGGAGG + Intergenic
910560576 1:88586075-88586097 TTGGGCAGGTGTATGTGTCCAGG - Intergenic
911772683 1:101766943-101766965 GTATGCATGTGTATGTATCTAGG - Intergenic
912119340 1:106451025-106451047 GTGTGTATGTGCATATGTGTGGG - Intergenic
912285555 1:108364967-108364989 GTGTGTCTGTGTGTGTGTCCAGG + Intergenic
913076868 1:115347568-115347590 GTGTGCCTGTGTATGTGTGCTGG - Intergenic
913323823 1:117608891-117608913 GTGTGCATGTGTGTGTGTTTAGG + Intronic
913936940 1:125064388-125064410 GTGTGTGTCTGCATGTGTCTGGG - Intergenic
914471357 1:147981314-147981336 GTGTGTATGTGTGTGTGTCGGGG - Intronic
915008539 1:152663407-152663429 CTGTGCTTTTGCATGTGACCAGG + Exonic
915293489 1:154902550-154902572 GTGTGCATGTGTGTGGGTTCAGG - Intergenic
915293490 1:154902556-154902578 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
915530154 1:156498640-156498662 GTGTGCATGTACATTTGTAAAGG - Intronic
915560705 1:156685753-156685775 ATGGGCATGTGCATGTGCCCAGG - Intergenic
915790951 1:158670567-158670589 GTATGTATGTGCATGTGGCAAGG + Intronic
915929851 1:160053616-160053638 GTGTGTGTGTGTGTGTGTCCTGG + Intronic
916152663 1:161810562-161810584 ATGTGCAAGTGCATTTGTCTGGG + Intronic
916559967 1:165926200-165926222 GTGTGTATGTGCATGTGTCAGGG + Intergenic
916906073 1:169285071-169285093 ATGTGCATGTGTGTGTGTACAGG + Intronic
917000062 1:170347860-170347882 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
917418728 1:174839326-174839348 GTGTGGATGTGCATGTGAGAGGG - Intronic
917791755 1:178503637-178503659 GTGTGTATGTGCGTGTTTCTTGG - Intergenic
918143729 1:181738274-181738296 GTGCACGAGTGCATGTGTCCTGG + Intronic
919433611 1:197529390-197529412 GTGTGCATATGCGTGTGCCAGGG + Intronic
919776495 1:201197469-201197491 GTGTGCATGTGGATGAAGCCCGG - Intronic
919861928 1:201745251-201745273 GTGTACATATGCATGTGTGTGGG - Intronic
919976032 1:202613411-202613433 GTGTGCATGTGTGTGTGTGCTGG + Intronic
920599492 1:207309071-207309093 GTATGCATATGCATGTGTACAGG - Intergenic
920868236 1:209770942-209770964 GTGTGCGTGTGCATGTGGAGGGG + Intronic
921069774 1:211649387-211649409 GTGTGCAAGCTGATGTGTCCAGG - Intergenic
921445377 1:215240415-215240437 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
922258383 1:223913056-223913078 GCATGCATGTGCATGTGTGTTGG + Intergenic
922365916 1:224863574-224863596 TTGTTCATGTGCACGTGTTCAGG + Intergenic
922746386 1:228046558-228046580 GTGTGCATGTGCATGGGGTGGGG + Intronic
923380247 1:233410627-233410649 GTGTGCATGTGCATATATGCTGG - Intergenic
923667083 1:236007979-236008001 GTGTGCATGGGCTGGTGTACTGG - Intronic
923835207 1:237603458-237603480 TTTGGCATGTGCATGTGGCCGGG - Intronic
924218009 1:241845385-241845407 GTGTGCATGTGTGTGTGTGGTGG + Intergenic
924339583 1:243015819-243015841 GCATGCATGTGCATGTGTATTGG + Intergenic
924861223 1:247924687-247924709 GTGTGCATGTGTATATGTGTGGG - Intergenic
1062773222 10:121634-121656 TTGGGCAGGTGTATGTGTCCAGG + Intergenic
1062993398 10:1842082-1842104 GTCTGTATGTGCATGTGTGGGGG - Intergenic
1063054567 10:2490400-2490422 GTATGCATGTGCGTGTGTGTGGG - Intergenic
1063057443 10:2521146-2521168 GTGTGGATGTGGGTGTCTCCTGG - Intergenic
1063057449 10:2521174-2521196 GTGTGGATGTGGGTGTCTCCTGG - Intergenic
1063196324 10:3747147-3747169 GTCTGCAGGAGCATGTGGCCAGG + Intergenic
1063539067 10:6913824-6913846 GTGTGCATGTGTCTGTGTATTGG - Intergenic
1063588990 10:7378067-7378089 GTGTGCATGTGTATGTGGATGGG + Intronic
1063624142 10:7673671-7673693 GTGTGCATGCGCATGAGCCCAGG - Intergenic
1063946299 10:11179699-11179721 GTGTGCGTGTGCCTGTGTTGGGG + Intronic
1064120683 10:12615718-12615740 GTGTGAGTGTGCATGTGTGTGGG + Intronic
1064630912 10:17309653-17309675 GTGTGGGTGTGAATGTGTCCTGG + Intergenic
1065122231 10:22541516-22541538 GTGTGTATGTGCATATGTACAGG + Intronic
1065897475 10:30176788-30176810 CTTTGCATGTGGATGTGTCAGGG - Intergenic
1065997592 10:31073699-31073721 GTGTGCGTGCGCATGTGTGTAGG + Intergenic
1066206098 10:33190796-33190818 GTGTGTGTGTGCATGTGTGTTGG + Intronic
1066332098 10:34434890-34434912 GTGTGAATGTGAATATGTGCTGG - Intronic
1066482899 10:35814084-35814106 GTGTGTATGTGCATGTGTTCGGG - Intergenic
1066502370 10:36006631-36006653 GTGCACATGTGTATGTGTACTGG + Intergenic
1067081495 10:43215061-43215083 GTGTGCTTGTCCACATGTCCAGG - Intronic
1067442556 10:46317706-46317728 GTGTGTGTGTGCATGTGTTTTGG - Intronic
1067582350 10:47453656-47453678 GTGTGCATATGTGTGTGTGCGGG - Intergenic
1068183407 10:53552070-53552092 GTGTGTATGTGTATGTGTACAGG - Intergenic
1068704113 10:60054103-60054125 GTGTACATGTGCATATGTATGGG - Intronic
1068983076 10:63081914-63081936 GGGTCAATGTGCATGTGGCCAGG - Intergenic
1069655880 10:70088095-70088117 GTGTGCATGTGGGTATGTGCTGG - Intronic
1070547238 10:77462562-77462584 GTGTGTAAGTGCATGTGTGAGGG - Intronic
1070720697 10:78754997-78755019 GTGTGTGTGTGTGTGTGTCCAGG + Intergenic
1070802870 10:79253859-79253881 GTGTGCATGTACCTGTGTGTGGG - Intronic
1070909294 10:80103458-80103480 GTGTGCATGTGTGTGTGTGGTGG + Intergenic
1070911950 10:80126758-80126780 GTGTGAATGTGGATGTCTCTCGG - Intergenic
1071074885 10:81738318-81738340 TTGGGGATGTGTATGTGTCCAGG - Intergenic
1071293833 10:84205214-84205236 GTGTGCATGTCTATATGCCCCGG + Intronic
1071517622 10:86309464-86309486 GCCTGCATGCTCATGTGTCCTGG + Intronic
1071876614 10:89850018-89850040 GTGTGTATGTGTGTGTGTCTAGG + Intergenic
1072061673 10:91818536-91818558 GTGTGCATGTGTGTGTATCAAGG + Intronic
1072070340 10:91909099-91909121 GTTCGCAGGTGCATGTGTCTGGG - Intronic
1072292616 10:93978189-93978211 GTATGTGTGGGCATGTGTCCTGG - Intergenic
1072627504 10:97122582-97122604 AAGTGCATGTGCATCTGTCCAGG + Intronic
1072724991 10:97807227-97807249 GTGTGTGTGTGTTTGTGTCCAGG + Intergenic
1073007237 10:100333986-100334008 GAGTGCAGGTGCATGTGTGTGGG + Intergenic
1073070281 10:100788873-100788895 GTGTGCATGTATGTGTGTCGGGG - Intronic
1073081560 10:100863926-100863948 GTGTGTGTGTGTGTGTGTCCAGG - Intergenic
1073096753 10:100984595-100984617 GTGTGCATGTGAATGTACGCAGG - Exonic
1073217063 10:101842307-101842329 CTGTGCATGTGCATGTTCCTGGG - Intronic
1073511888 10:104047636-104047658 GTGTGCATGTGCAGGTGTGCAGG - Intronic
1073543283 10:104329032-104329054 GTGTGTGTGTGCATGCGTGCAGG - Intronic
1073771142 10:106737065-106737087 GTGTGTATGTGTAGGTGTCAGGG + Intronic
1073964465 10:108972773-108972795 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
1074779008 10:116786979-116787001 GTGTGTGTGTGTGTGTGTCCGGG - Intergenic
1074833756 10:117269194-117269216 GTGTGTATGTGTATGTGTGTAGG - Intronic
1074919101 10:117989167-117989189 GTGTGTGTGTGTATGTGTACAGG + Intergenic
1074979307 10:118606839-118606861 GTGTGGGTGTGCATGTATTCGGG + Intergenic
1075137911 10:119802456-119802478 TTGTGTATATGCATGTGTCAAGG - Intronic
1075813374 10:125245195-125245217 GTGTGCCTGTGCATTTTTCTGGG + Intergenic
1075816197 10:125266459-125266481 GTGTGCATGTGTGTGTGTATAGG + Intergenic
1076139335 10:128067205-128067227 GTGTGCATGTGAATGTGTGTGGG - Intronic
1076474295 10:130741825-130741847 GGGTGCATGTGCATGTTTTCTGG - Intergenic
1076489004 10:130843972-130843994 GGGTGCATGTGAATGTGCACCGG + Intergenic
1076509069 10:130999416-130999438 CTGGGCATGGGCATGTGCCCAGG - Intergenic
1076787013 10:132755079-132755101 ATGTGCATATGCATGTGAGCAGG + Intronic
1077223783 11:1429065-1429087 GTGTGCATGGGTGTGTGTCCTGG + Intronic
1077223795 11:1429156-1429178 GTGTGCACGGGTGTGTGTCCTGG + Intronic
1077351752 11:2096355-2096377 GCATGTATGTGCATGTGTGCAGG - Intergenic
1077631177 11:3812029-3812051 ATGTACGTGTGTATGTGTCCTGG + Intronic
1078065930 11:8079690-8079712 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1078408506 11:11092361-11092383 GTGTGTATGTGTATGTGGCTAGG - Intergenic
1078424800 11:11240408-11240430 GTGTACATGTGCATGTTTGTAGG - Intergenic
1078428071 11:11267407-11267429 CTGTGCATGGCCATGGGTCCTGG + Intergenic
1078610457 11:12814873-12814895 GTGTGTGTGTGCACGCGTCCCGG + Intronic
1078716780 11:13847297-13847319 GTGTGTGTGTGTGTGTGTCCTGG + Intergenic
1079015819 11:16867816-16867838 GTGTACACGTGCATGTGTGTAGG - Intronic
1079114144 11:17629892-17629914 GTGTCCATGTGCTTATGCCCCGG - Intronic
1079133663 11:17763862-17763884 GTGTACATGTGCATGTGTGGTGG - Intronic
1079227139 11:18616728-18616750 GTGTGTGTGTGTGTGTGTCCAGG - Intronic
1079691133 11:23418432-23418454 GTGTGCATGTGAATGTGTCCTGG - Intergenic
1080581983 11:33651684-33651706 CTGTGCATGTGCATTTACCCAGG - Intronic
1080776319 11:35390277-35390299 GTGTGCACGTGCCTGTGTGTGGG - Intronic
1081231772 11:40593368-40593390 GTGCACATGTGTATGTGTACAGG - Intronic
1081322366 11:41706758-41706780 GTGTGCATGTGTGTGTGTTTAGG + Intergenic
1081408482 11:42726314-42726336 GTGTGTATGTGTATGTGTGCTGG - Intergenic
1081650354 11:44819433-44819455 GTGCGCATGTGCATGTGTGTCGG + Intronic
1081675822 11:44968396-44968418 ATGTGCATTTGCATGTGGTCAGG + Intergenic
1083557438 11:63642071-63642093 GTGTGTATGTGTATGTCTCTAGG - Intronic
1083766538 11:64844165-64844187 GTATGTGTGTGCATGTGTCGGGG + Intronic
1084009946 11:66342031-66342053 GTGTGCATGTGTGTGTGTAGGGG + Intronic
1084360080 11:68663549-68663571 GTGTGCATGTGCGTCTGCCTGGG - Intergenic
1084386840 11:68848555-68848577 GTGTGCATGTGTGTGTTTCCAGG - Intergenic
1084609166 11:70190850-70190872 GTGTGTGTGTGCATATGTGCTGG + Intergenic
1084609169 11:70190971-70190993 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1084609170 11:70190993-70191015 GTGTGTGTGTGCATATGTGCTGG + Intergenic
1084609171 11:70191015-70191037 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1084609173 11:70191099-70191121 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1084609175 11:70191181-70191203 GTGTGTGTGTGCATATGTGCTGG + Intergenic
1084609176 11:70191223-70191245 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1084656574 11:70523149-70523171 GTGTGCTTCTGCATCTGCCCGGG + Intronic
1084676232 11:70637103-70637125 GTGTGTATGTGCACGTGTGTGGG + Intronic
1085153379 11:74270046-74270068 GTGTGTATGTGTGTGTGTCTTGG - Intronic
1085379773 11:76104677-76104699 GTGTGCATGTATATGTGTGGTGG - Intronic
1085784175 11:79437238-79437260 GTGTGTGTGTGCATGTGTTGGGG - Intronic
1086158987 11:83699926-83699948 GTGTGTGTGTGCATGTGTGGTGG - Intronic
1086243969 11:84728815-84728837 ATGTGAGGGTGCATGTGTCCAGG + Intronic
1087218136 11:95516986-95517008 GTGTTTATGTGCATGTGTAAGGG - Intergenic
1087478564 11:98669570-98669592 GTGTGCATGTGTGTGTGTGTTGG - Intergenic
1087676510 11:101168810-101168832 GTGTGCATGTGCAGCAGACCAGG - Intergenic
1087943324 11:104127709-104127731 GTGTGCATGTGTGTGTGTGAAGG + Intronic
1088183998 11:107143186-107143208 GTGTGTGTGTGTGTGTGTCCTGG - Intergenic
1088780442 11:113128939-113128961 GTGTGTGTGTGCATGCGTGCAGG + Intronic
1089162875 11:116452921-116452943 GTGTCCAGGAGCATGTCTCCGGG - Intergenic
1089456839 11:118630710-118630732 GTGTGCCTGTGCATCAGTGCTGG + Intronic
1089500028 11:118926242-118926264 GTGTGCGCGCGCGTGTGTCCAGG - Intronic
1090320143 11:125835978-125836000 GTGTGCATGGGCATGCATACAGG + Intronic
1090440828 11:126724362-126724384 GTCTGCATGTGCATGTGTGTGGG - Intronic
1090873921 11:130772059-130772081 GTGTGCATGTGCACGTGTGTGGG + Intergenic
1091150757 11:133326411-133326433 GTGTGGATATGCATGTGTGTGGG + Intronic
1091228814 11:133974613-133974635 GTGTGCATGTGTGTGTGTTCAGG - Intergenic
1091600503 12:1915131-1915153 GTATGCATATGCATGTGTGTGGG - Intronic
1091639956 12:2228940-2228962 GTGTGTGTGTGCATATCTCCTGG + Intronic
1091710853 12:2739125-2739147 ATGTGTGTGTGCATGTGTGCAGG + Intergenic
1092119306 12:6032995-6033017 GTATGCATGTGCGTGTGTGTGGG - Intronic
1092398609 12:8151480-8151502 TTGGGAATGTGTATGTGTCCAGG + Intronic
1092833991 12:12470838-12470860 GTGTGCGTGTCCATGCCTCCGGG + Intergenic
1093004744 12:14039188-14039210 GTGGGGAGGTGTATGTGTCCAGG - Intergenic
1093273474 12:17095363-17095385 GTGTGCATGTGGATGTGTATTGG + Intergenic
1094212706 12:27909470-27909492 GTGTGCATGTGCATGCATGTTGG + Intergenic
1094489839 12:30952914-30952936 GTGTGGGTGTGCAGGTGCCCAGG + Intronic
1094616177 12:32038362-32038384 GTGTCTGTGTGCCTGTGTCCTGG - Intergenic
1095739471 12:45591459-45591481 GTGTACATGTGCATTTTTCTAGG + Intergenic
1095812877 12:46389430-46389452 GTGTGTGTGTGTGTGTGTCCTGG - Intergenic
1096225555 12:49864738-49864760 ATGTGCATGTGTGTGTGTGCAGG + Intergenic
1096391019 12:51229135-51229157 GTGTGTATGTGCGTGGGGCCCGG + Intergenic
1096747978 12:53740898-53740920 CTGTGTATCTGCATGTGTGCAGG + Intergenic
1097764730 12:63512528-63512550 GTGTGTGTGTGCGTGTGTGCAGG + Intergenic
1097823386 12:64150134-64150156 GTGTGCATGTGCACGTGTGTGGG + Exonic
1098125226 12:67284778-67284800 GTGTGTATGTGTGTGTGTCGGGG - Intronic
1098389468 12:69953760-69953782 GTGTGTGTGTGTGTGTGTCCGGG - Intronic
1098527868 12:71507429-71507451 CTGTGTCTGTGCATGTGTCTGGG + Intronic
1099317438 12:81102412-81102434 CTGTGCATGTGCATGGGCGCAGG + Intronic
1100615258 12:96226429-96226451 GTGTGTGTGTGCATGTGGACAGG - Intronic
1101019911 12:100543571-100543593 GTGTGTGTGTGTGTGTGTCCAGG + Intronic
1101098427 12:101367895-101367917 GTCTTCAGGTGAATGTGTCCTGG + Exonic
1101413455 12:104488385-104488407 GTGTATGTGTGCGTGTGTCCAGG + Intronic
1102412608 12:112733196-112733218 GTGTGCAGGTGTGTGTGTACGGG - Intronic
1102459381 12:113090806-113090828 TTGTGCCTCTGCATGTGTGCAGG + Intronic
1102714396 12:114957257-114957279 GTGTGCCTGTGCGTGTGAACAGG - Intergenic
1103516494 12:121511828-121511850 GTGTGCCAGTGCCTGTGCCCAGG - Intronic
1103723218 12:122985714-122985736 GTGTGGATCTCCAAGTGTCCTGG - Exonic
1103907213 12:124333858-124333880 GTGTGTGTGCGCATGTGTGCGGG + Intronic
1103907215 12:124333892-124333914 GTGTGCGCGCGCATGTGTGCGGG + Intronic
1103907219 12:124333946-124333968 GTGTGCACGTGTGTGTGTGCGGG + Intronic
1103936334 12:124479207-124479229 GTGTGCATGTGTTTGTGCGCAGG - Intronic
1103950133 12:124545931-124545953 GTGTGGCTTTGCATGTGTCCTGG - Intronic
1103971731 12:124676846-124676868 GCGGGCATGTGCGTGTGTGCCGG + Intergenic
1104035233 12:125092984-125093006 GTGTCCATGGGCAAGTGCCCTGG + Intronic
1104168431 12:126256576-126256598 GTATGAATGTGCATGTGTATTGG + Intergenic
1104470267 12:129024644-129024666 GTGAGCATGTGGATGTGTGTGGG - Intergenic
1104578482 12:129990585-129990607 GCGTGCGTGTGCATGTGTTTAGG - Intergenic
1104752241 12:131247113-131247135 GTGTGTGTGTGTGTGTGTCCGGG - Intergenic
1104779681 12:131412017-131412039 GTGTGTGTGTGTGTGTGTCCGGG + Intergenic
1104917967 12:132275868-132275890 GTGTGCATGTGTGTGTGCCCAGG + Intronic
1104919693 12:132284250-132284272 GTGTGCACCTGCATGTGTGCGGG - Intronic
1104944948 12:132411438-132411460 GTGTGCATGTGTGTGTGTGTGGG - Intergenic
1104971198 12:132531409-132531431 GTGTGCATGTGCGTGTGGGCAGG + Intronic
1105532048 13:21229250-21229272 GTGTGAATGTGCATGTGGGGTGG - Intergenic
1105638179 13:22236370-22236392 GTGTGTGTATGCATGTGTGCAGG + Intergenic
1105962557 13:25355307-25355329 GTGTGCATGTGTGTGTGTGGGGG - Intergenic
1106145097 13:27043273-27043295 ATGAGCATGTGCCTGTATCCAGG - Intergenic
1106643699 13:31610911-31610933 GTGTGCATTAGCATGTGTGGTGG + Intergenic
1106835847 13:33634704-33634726 GTGTGCATGTGTGTGTGTGGCGG - Intergenic
1107080691 13:36371570-36371592 GTGTGTATGTGTGTGTGTTCTGG - Intergenic
1107403040 13:40087584-40087606 GTGTGCATGTGCACATTTGCTGG + Intergenic
1107733634 13:43373573-43373595 GTGTGTATGTGTATGTGTGTGGG - Intronic
1108004361 13:45932334-45932356 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1108012599 13:46035055-46035077 ATGAGCATGTGCTTGTGCCCTGG - Intronic
1108383333 13:49875107-49875129 GTGTGTATGTGTGTGTGTCCAGG + Intergenic
1108809619 13:54205472-54205494 GTGTGCCTGTGCAAATGGCCTGG + Intergenic
1108868040 13:54945426-54945448 GTGTGTATGTGCATATGTAAGGG + Intergenic
1108888787 13:55226790-55226812 GTGTGCATCTACATGTGTGCTGG - Intergenic
1109034158 13:57233336-57233358 TTGGGAAGGTGCATGTGTCCAGG - Intergenic
1109144833 13:58766344-58766366 GTGTGTTTGTGTATGTGTGCTGG + Intergenic
1109195543 13:59374403-59374425 GTGTGTATGTGCACGTGTATGGG - Intergenic
1109442260 13:62390936-62390958 GTGTGCATGTGTGTGTGTCTTGG + Intergenic
1109541034 13:63779153-63779175 TTGGGAAGGTGCATGTGTCCAGG + Intergenic
1110370360 13:74733094-74733116 GTGTGTATGTGCATGTGTTTAGG - Intergenic
1110500793 13:76225340-76225362 GTGTGTGTGTGCATGTGTTTAGG - Intergenic
1111173823 13:84565913-84565935 GTGTTCATGTGGATGTGGCTAGG - Intergenic
1111617372 13:90677704-90677726 GTGTGCATGTGTGTGTGTATGGG + Intergenic
1111816168 13:93156160-93156182 GTGTGCATATCTATGTGTCTGGG - Intergenic
1112439337 13:99414509-99414531 GTGTGAGTGTGCATGTGTTTGGG - Intergenic
1113186144 13:107687491-107687513 GTGTGTGTGTGCATGTGCACTGG - Intronic
1113504161 13:110801703-110801725 ATGTGGATGTGCAGGGGTCCTGG + Intergenic
1113613808 13:111666491-111666513 GTGTGCATGTGCATGTGTGCAGG + Intronic
1113734235 13:112665877-112665899 GTGTGCATGTGTGAGTGTGCGGG + Intronic
1113742512 13:112721421-112721443 GTGTGCATTTGGATATGTCGAGG + Intronic
1113913862 13:113859750-113859772 GTGTGCATGTGTCTGTGTGTGGG + Intronic
1114517538 14:23309431-23309453 GTGTGCATGTGCACGCATGCTGG + Exonic
1114887659 14:26873852-26873874 GTGTACACGTGCTTGTGTGCTGG - Intergenic
1114992613 14:28306335-28306357 GTGTGTGTGTGCATGTGTGAAGG + Intergenic
1115322876 14:32104041-32104063 TTGTGCATGTGCATTTTTCTAGG - Intronic
1115385787 14:32795050-32795072 TTGTGAGGGTGCATGTGTCCAGG - Intronic
1115914010 14:38289392-38289414 GTGTGTATGTGTGTGTGTCCAGG - Intergenic
1116296157 14:43113071-43113093 GTGTGTATGTGTGTGTGTCTAGG - Intergenic
1117963995 14:61188638-61188660 GTGTGTGTGTGTGTGTGTCCGGG + Intronic
1118323076 14:64764694-64764716 GTCTGCATGTGGCGGTGTCCTGG - Intronic
1118323336 14:64765887-64765909 GTGTGCATGTGTGTGTGTGTGGG + Intronic
1118323389 14:64766286-64766308 GTGGGCATGTGCCTGTGTGTAGG + Intronic
1118616372 14:67577031-67577053 GAGTGCAGGTGGATGTGTGCAGG - Intronic
1118629913 14:67693532-67693554 GTGTGTATGTGCATGCGTGTGGG - Intronic
1118737583 14:68713140-68713162 GTGTGAATGAGCTGGTGTCCGGG - Intronic
1119074642 14:71623978-71624000 CAGTGCATGTACATGTGTTCAGG + Intronic
1119207318 14:72804176-72804198 GTGTGTGTGTGTGTGTGTCCTGG - Intronic
1119431394 14:74570290-74570312 TTGTGCATGGGCATGTGTGGGGG - Intronic
1119724899 14:76916156-76916178 GTGCACATGTGCTTGTGACCAGG + Intergenic
1120435306 14:84474325-84474347 GTGTGTGTGTGCATGTGTTGTGG + Intergenic
1121185415 14:91963265-91963287 GAGTACATGTGCATGTGGCATGG + Intergenic
1121213714 14:92230160-92230182 TTGGGCAGGTGTATGTGTCCAGG + Intergenic
1121702238 14:95963270-95963292 GTGTGTATGTGCCTGTGTGTGGG - Intergenic
1122090093 14:99332357-99332379 GTGTGCTTGTGTGTGTGTGCTGG - Intergenic
1122090130 14:99332900-99332922 GTGTGCTTGTGTGTGTGTGCTGG - Intergenic
1122090153 14:99333241-99333263 GTGTGCTTGTGTGTGTGTGCTGG - Intergenic
1122324345 14:100873703-100873725 GTGTCCCTGTGCATGTGTGTTGG + Intergenic
1122878828 14:104680825-104680847 GTGTGCATGTGAATTTTCCCGGG - Intergenic
1122986771 14:105215463-105215485 GTGTGTGTGTGCATGTGTTCTGG - Intronic
1123040613 14:105488797-105488819 GTGTACATGCGCGTGTGTGCTGG + Intronic
1123057816 14:105580213-105580235 GTGTGGATCTGCAGGTTTCCTGG + Intergenic
1123082099 14:105700146-105700168 GTGTGGATCTGCAGGTTTCCTGG + Intergenic
1124054606 15:26230735-26230757 GTGTGCATGTGTGTGTGTTGAGG - Intergenic
1124200182 15:27672709-27672731 GCGTGCATGTGCATGTGTGTGGG - Intergenic
1124250876 15:28105924-28105946 GGGTGTGTGTGCATGTGTCTGGG + Intergenic
1124250916 15:28106230-28106252 GTGTGTGTGTGCATGTGTCGGGG + Intergenic
1124503932 15:30255562-30255584 GTGGGCTTGTGCAAGTGTGCAGG - Intergenic
1124739622 15:32283078-32283100 GTGGGCTTGTGCAAGTGTGCAGG + Intergenic
1124950073 15:34310199-34310221 GTGTGTGTGTCCCTGTGTCCAGG + Intronic
1124950098 15:34310368-34310390 GTGTGTGTGTCCCTGTGTCCAGG + Intronic
1125435379 15:39638836-39638858 GTGTGCATGTGTGTGTGTGGTGG + Intronic
1125743556 15:41984111-41984133 GTGTGCAGGTGCGTGTGTGAGGG - Intronic
1125910391 15:43432745-43432767 GTGTGCATGTGTGTGTGTAGTGG + Intronic
1125920039 15:43519975-43519997 GTGTGCATGTGTATTAGTGCGGG + Intronic
1127564571 15:60174303-60174325 GTGTGTATGTGCATTTGTAGTGG - Intergenic
1127605487 15:60583259-60583281 GTGTGTATCTGCCAGTGTCCAGG - Intronic
1127665848 15:61146443-61146465 GTGTGTATGTGTATGTGTGTTGG - Intronic
1127677369 15:61254047-61254069 GGGTGCATGTGCAGATGTGCAGG - Intergenic
1127745928 15:61972482-61972504 GTGTGTATGTGCATGTGTGTTGG + Intronic
1128008582 15:64269400-64269422 TTGGGCAGGTGTATGTGTCCAGG + Intronic
1128054263 15:64688156-64688178 GTGTGCATTTGCGTCTGGCCTGG - Exonic
1128301860 15:66570973-66570995 GTGTGCATGTGTGTGGGTCCAGG + Intergenic
1128519406 15:68365564-68365586 GTGTGTGTGTGCACGTGTACAGG + Intronic
1128716715 15:69913964-69913986 GTGTGCATGTGTGTGTGTGTTGG + Intergenic
1129135629 15:73547849-73547871 CTTTGCCTGTGCCTGTGTCCTGG - Intronic
1129710793 15:77819447-77819469 GTGTGCATGTGCGTGTGCGCGGG + Intronic
1129894098 15:79090933-79090955 GTGTGCGTGTGTGTGTGTCTGGG - Intergenic
1130000443 15:80041926-80041948 GTGTGCATGGCTATGTGTGCCGG + Intergenic
1130125176 15:81087870-81087892 GTGTGCATGTGTGTGTGTGTGGG - Intronic
1130620791 15:85460285-85460307 ATGTGCATATGCATTTGTACAGG + Intronic
1130835695 15:87647448-87647470 ATGTCCATGAGCATGTGCCCAGG + Intergenic
1131329847 15:91486842-91486864 TTTTGTATGTGCCTGTGTCCAGG + Intergenic
1131543980 15:93300187-93300209 GTGTGCATGTGTCTATGTGCAGG + Intergenic
1132649274 16:1013182-1013204 GGGTGTGCGTGCATGTGTCCTGG - Intergenic
1132973927 16:2702183-2702205 GTGTGCTCGTGCAGGTGTTCCGG + Intronic
1132994233 16:2814766-2814788 GTGTGCATTTGGGTGAGTCCTGG - Intergenic
1133555136 16:6899299-6899321 GTATGCATGTGTATGTTTCAGGG + Intronic
1134056305 16:11171865-11171887 GTGTGAGTGTGTATGTGCCCTGG - Intronic
1134056306 16:11171917-11171939 GTGTGAGTGTGTATGTGTACTGG - Intronic
1134059843 16:11192496-11192518 GTGTGTGTGTGCATGTCTCTGGG - Intergenic
1134107856 16:11496724-11496746 GTGTGCCTATGCATGTGTCCAGG + Intronic
1134308954 16:13058779-13058801 GTGTGAATGTGTATGTGTGGTGG + Intronic
1134331661 16:13256914-13256936 GTGTGTATGTGTATGTTTCTGGG - Intergenic
1134782249 16:16908895-16908917 GTGTGTGTGTGCGTGTGTCTGGG + Intergenic
1135463458 16:22664843-22664865 GGGTGCATGTGCAAGGGTCCTGG + Intergenic
1135608481 16:23843950-23843972 GTGTGTGTGTGCATGTGTGATGG - Intronic
1135791390 16:25399936-25399958 GTGTGCATGTGTGTGTCCCCAGG + Intergenic
1135856079 16:26011729-26011751 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1136020905 16:27439179-27439201 GCGTGAGTGTGCATGTGTCTGGG - Intronic
1136104212 16:28017657-28017679 TTGTGCATGTTGATGTGTGCAGG - Intronic
1136228005 16:28871993-28872015 GTGTGAGTGTGCATGTCTCCAGG + Intronic
1136553086 16:30992086-30992108 GTGTGTGTGTGTGTGTGTCCAGG - Exonic
1137458384 16:48635773-48635795 GTGTGTATGTGCGTGTGTGTGGG + Intergenic
1138162097 16:54763964-54763986 GTGTGCATGTGTCTGTGTTGAGG - Intergenic
1139474078 16:67193818-67193840 GTGTGTATTTGCTTGTGTGCAGG + Intronic
1139594701 16:67950874-67950896 GGGTGTCTGTGCATGTGACCTGG + Intronic
1139652333 16:68368648-68368670 GAGTGAATGGGGATGTGTCCTGG + Intronic
1139671006 16:68492553-68492575 CTGTGCAGGTGCAGGAGTCCAGG + Intergenic
1140513583 16:75526225-75526247 GTGTGCATGTGTGTGTGTGGGGG + Intergenic
1140871297 16:79109065-79109087 GTGAGCATGTGTGTGTGCCCTGG + Intronic
1141062485 16:80886712-80886734 GTGTGCATGTGCATGGCTGAGGG + Intergenic
1141216425 16:82029252-82029274 GCGTGGATGTGCATGTGTGCAGG - Intergenic
1141243302 16:82283295-82283317 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1141649044 16:85383279-85383301 TTGTGCACATGCATGTGTGCTGG - Intergenic
1141759699 16:86019825-86019847 GTGTGTGTGTGCATGTGTTCAGG - Intergenic
1141869875 16:86777956-86777978 CTTGGCATGTCCATGTGTCCCGG - Intergenic
1141928946 16:87187935-87187957 GTGTGCATGTGTACGTGTGTGGG + Intronic
1141929003 16:87188385-87188407 GTGTGCGTGTGCATGTGTGTGGG + Intronic
1141929008 16:87188440-87188462 GTGTACGTGTGCATGTGTGTGGG + Intronic
1142178040 16:88653947-88653969 GTGGGGATGTGCGTCTGTCCCGG - Intronic
1142259135 16:89034400-89034422 GTGTGCATGTGAGTGTGTGCAGG - Intergenic
1142454378 16:90209855-90209877 GCATGCATGTGCATGTGTGTTGG - Intergenic
1142514042 17:415343-415365 GTGTGTGTGTGTGTGTGTCCTGG + Intronic
1142514045 17:415399-415421 GTGTGTGTGTGTGTGTGTCCTGG + Intronic
1142753017 17:1999625-1999647 GTGTATTTGTGCATGTGTGCAGG - Intronic
1143560787 17:7693303-7693325 GTGTGACTGTGCATCTTTCCTGG + Intronic
1143679091 17:8462808-8462830 GTGTGTGTGTGCATGTGTGCGGG + Intronic
1143785824 17:9254735-9254757 GTGTAGATGTTCATGTGTCCAGG - Intronic
1144427353 17:15156060-15156082 GTGTGTGTGTGTGTGTGTCCAGG - Intergenic
1144518432 17:15937507-15937529 TTGTGCATGTGCATAGGCCCAGG - Intergenic
1144761512 17:17710127-17710149 GTGTGAAAGTGCACGTGACCAGG - Intronic
1145264244 17:21371920-21371942 GTGTGGGTGTGACTGTGTCCTGG + Intergenic
1145946328 17:28777710-28777732 GTGTGTATGTGTGTGTGTACAGG + Intronic
1146845681 17:36180434-36180456 GTGTGCATGTGTGTGTGTGCAGG + Intronic
1146873898 17:36392301-36392323 GTGTGCATGTGTGTGTGTGCAGG + Intronic
1146969846 17:37063722-37063744 GTATGTATGTGCATGTGTATCGG + Intergenic
1147055848 17:37834308-37834330 GTGTGGATGTGGATGTGTGTGGG - Intergenic
1147065492 17:37920572-37920594 GTGTGCATGTGTGTGTGTGCAGG - Intergenic
1147088689 17:38078376-38078398 GTCTGCATGTGCATATGTGGGGG + Intergenic
1147108521 17:38242149-38242171 GTCTGCATGTGCATATGTGGGGG - Intergenic
1147177009 17:38662233-38662255 GTGTGCATGTGCATAGGAGCAGG + Intergenic
1147386742 17:40087233-40087255 GTGTGTGTGTGCCTGTGTGCTGG - Intronic
1147386749 17:40087403-40087425 GTGTGTGTGTGCCTGTGTGCTGG - Intronic
1147458279 17:40552262-40552284 GTGTGCGTGAGCGTGTGGCCAGG - Intergenic
1147585503 17:41651907-41651929 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
1147986896 17:44312028-44312050 GTGGGCATGCGCAGGTGGCCAGG - Intronic
1148228361 17:45915394-45915416 GTGTGCATGAGCATGTGTGTGGG + Intronic
1148331461 17:46816464-46816486 GTGTGTGTGTGCGTGTGTTCTGG - Intronic
1148854514 17:50571418-50571440 GTGTGCGTGTGAATGTGTGCGGG + Intronic
1148855619 17:50577778-50577800 GTGTGCAAGTGCACGTGTGTGGG + Intronic
1149200593 17:54181645-54181667 GTGTGCACATGCATGTGTGTGGG + Intergenic
1149225224 17:54462622-54462644 TTGAGAAGGTGCATGTGTCCAGG + Intergenic
1149423400 17:56532080-56532102 AAGTGCATGTGTATGTGTGCAGG - Intergenic
1150105051 17:62456506-62456528 ATGTGCATGTGTGTGTGTCTAGG + Intergenic
1150816761 17:68398315-68398337 GTATACATATGCATATGTCCAGG + Intronic
1150958322 17:69887057-69887079 GTGTACATGTGAGTGTGTGCAGG - Intergenic
1150976373 17:70091594-70091616 GTGTGTGTGTGTATGTGTACTGG - Intronic
1151187805 17:72376551-72376573 GTGTGCATGCGCGTGTGTGAGGG - Intergenic
1151340914 17:73470384-73470406 GTGTGCAAATGTCTGTGTCCAGG - Intronic
1152128779 17:78463553-78463575 GTGTGCATGTGTATATGTGCAGG - Intronic
1152239672 17:79154854-79154876 CTGTGCATGTGCACCTGTGCAGG - Intronic
1152470087 17:80486282-80486304 GTGTGCATGTGCAGGGGGCAGGG + Intergenic
1152512413 17:80799364-80799386 GTGTGGATGTGCAGATGTCAGGG + Intronic
1152882756 17:82829186-82829208 GTGTGCATGTGCACGTCTGCGGG - Intronic
1153180982 18:2432723-2432745 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
1153317212 18:3735979-3736001 GTGTGTGTGTGCATGTGGCATGG - Intronic
1153960351 18:10134958-10134980 GTGTGTCTGTGCATGTGGCAGGG - Intergenic
1153961648 18:10145269-10145291 GTGTGTCTGTGCATGTGGCAGGG - Intergenic
1153978207 18:10287768-10287790 GTGTGCATGTGAGTGTGTGGGGG + Intergenic
1154285388 18:13051371-13051393 GTGTGTGTGTGCGTGTGTGCGGG + Intronic
1154300824 18:13190926-13190948 GTGTGTGTGTGCGTGTGTGCGGG + Intergenic
1154351864 18:13590007-13590029 GTGTGGCTGTGCATGTGTATGGG + Intronic
1154473957 18:14733675-14733697 GTGTGTGTGTGTATGTGTACAGG + Intronic
1155061582 18:22233472-22233494 GTGTTCGTGTGCCTGTGTCAAGG + Intergenic
1155618738 18:27751312-27751334 GTGTGCATGTGTGTGTGTGGGGG + Intergenic
1155867669 18:30985922-30985944 GTGTGCAAGTGCATGTGTGTGGG + Intergenic
1156432676 18:37092501-37092523 GTGTGCATGGGCATCAGTCGTGG - Intronic
1156476271 18:37407503-37407525 ATGTGTGTGTGCATGTGTACAGG + Intronic
1156518282 18:37699370-37699392 GTGTGTATGTGTATGTGTGGTGG + Intergenic
1156687494 18:39667697-39667719 GTGTGTGTGTGCGTGTGTGCAGG - Intergenic
1157405794 18:47421708-47421730 GTGTGTGTGTGTCTGTGTCCAGG - Intergenic
1157410530 18:47459293-47459315 GTGTGCATGTGTGTGTTTGCAGG + Intergenic
1157701043 18:49761729-49761751 GTGTGCATGGGGATGTGTGGAGG - Intergenic
1157701081 18:49761842-49761864 GTGCGCATGTGGATGTGTGGGGG - Intergenic
1158008432 18:52700145-52700167 GTGTGCATGTGTGTGTGTGTGGG - Intronic
1158109352 18:53923277-53923299 TTCTGCATGGGCATCTGTCCTGG - Intergenic
1158120004 18:54038434-54038456 GTGTGCATGTGTGTGTGTGGGGG - Intergenic
1158412457 18:57220163-57220185 GTGTGTATGTGCATATTGCCAGG - Intergenic
1159904416 18:74077163-74077185 GTGTGCATATGCAGGTGGCCAGG - Intronic
1160008492 18:75086835-75086857 GTGTGAATATGCATGTGTGTGGG + Intergenic
1160523443 18:79521995-79522017 GTGTGTCTGTGCATGTGTGGGGG + Intronic
1160572601 18:79828729-79828751 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572603 18:79828784-79828806 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572606 18:79828842-79828864 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572612 18:79829009-79829031 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572614 18:79829064-79829086 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572617 18:79829122-79829144 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572620 18:79829180-79829202 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160575574 18:79851804-79851826 GTGTGAATGTGCATGTGAATGGG + Intergenic
1160686038 19:437020-437042 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1161248269 19:3267103-3267125 GTGTGCGTGTGCGTGTGTGTTGG + Intronic
1161755759 19:6133012-6133034 GTGTGCATATGTATGTGTCTTGG + Intronic
1161929878 19:7332058-7332080 GTGAACAGGTGCATGTGTCTGGG + Intergenic
1162129532 19:8517564-8517586 GTGTGTGTGTGCGTGTGTGCAGG + Intergenic
1162847805 19:13406916-13406938 GTGTGAATGTGCTTGTGTGTTGG - Intronic
1164527699 19:29023942-29023964 GTGCACATGTGCAGGTGTCTGGG + Intergenic
1164649470 19:29881641-29881663 GTGTGCATCTGCAAATGTCGTGG + Intergenic
1164802548 19:31089666-31089688 GTGTGCATGCACACGTGTTCTGG + Intergenic
1165192156 19:34073905-34073927 GTGTGTATGTGCATGTGTGCGGG + Intergenic
1165391122 19:35539560-35539582 GTGTGTATTTGCATGTGTGTGGG - Intronic
1165532717 19:36417814-36417836 GAGTGCACGTGCGTGGGTCCGGG + Intronic
1165725841 19:38112138-38112160 GGATGCATGTGCCTGTGTGCAGG - Intronic
1167140654 19:47648296-47648318 GTCGGCCTGTGGATGTGTCCCGG + Intronic
1167566493 19:50260895-50260917 GTGTGCATGCGTTTGTGTGCAGG + Intronic
1167660906 19:50795307-50795329 GTGTGCATGTGTCTGTGTGACGG + Intergenic
1167675920 19:50885468-50885490 GTGTGCATGTACATGGGTGGTGG + Intergenic
1167679463 19:50910227-50910249 GTGTGCATGGGCTTGTGGCTTGG - Intronic
1168145394 19:54417167-54417189 GTGTGCATGTGAGTGTGTAATGG - Intronic
1168145405 19:54417286-54417308 GTGTGCATGTGAGTGTGTAATGG - Intronic
1168304652 19:55428997-55429019 GTGTGCATTTGCATTTGTTGGGG + Exonic
925261229 2:2530229-2530251 GTGTGCAGCTGCCTGTGCCCTGG - Intergenic
925577119 2:5371350-5371372 GTGTGAGTGTGTATGTGTGCAGG - Intergenic
925991888 2:9260842-9260864 GTCATCATTTGCATGTGTCCAGG - Intronic
926054407 2:9766060-9766082 GTGTGCATGTGGGTGTGTAGAGG - Intergenic
926469824 2:13240208-13240230 GTGTGCATATGCATATGTTGGGG + Intergenic
926888336 2:17617860-17617882 ATGTGCATGTGCATGTATGCAGG - Intronic
926923715 2:17965382-17965404 GTGTGCATGTGTGTGCATCCAGG + Intronic
927305290 2:21564454-21564476 GTGTACATGTACATGTGTTAGGG + Intergenic
927346398 2:22048178-22048200 TTGTGCATGTGCATGCATGCAGG - Intergenic
927779609 2:25928856-25928878 ATGTGCGTGTGCGTGTGTGCAGG - Exonic
927853147 2:26512428-26512450 GTGTGCATGTGAGTGTGGTCAGG + Intronic
928171301 2:29005189-29005211 GTGTGTGTGTGCATGTGTGTGGG + Intronic
929443415 2:41984116-41984138 GTGTGCATGTGTGTGTGTTTGGG + Intergenic
929475376 2:42241856-42241878 GTGTGTATGTGTGTGTGTCGGGG + Intronic
930004034 2:46881927-46881949 GTGTGCTGGTGCATGTGTTTGGG + Intergenic
930232193 2:48854661-48854683 GTGTGTGTGTGTGTGTGTCCTGG + Intergenic
930633724 2:53782354-53782376 GTATGCATGTGTGTGTGTTCTGG - Intronic
931785349 2:65613142-65613164 GTGTGTGTGTGTGTGTGTCCAGG - Intergenic
931937449 2:67214596-67214618 GTGTGGGTGTGTATGTGTCGGGG - Intergenic
932493065 2:72133685-72133707 GTGTGCGTGTGTATGTGTGGGGG + Intronic
932926513 2:75981256-75981278 GTGTGCGTGTGCGTGTGTGCAGG - Intergenic
933239700 2:79906344-79906366 GTGTGCATGCACATGTGCACGGG - Intronic
934033621 2:88069435-88069457 GTGTGTATGTGTATGTGTCAGGG + Intronic
935120720 2:100181309-100181331 GTGTGTATGTACATGTGTTGGGG + Intergenic
935446266 2:103159627-103159649 GTGTGCATGTGTATGTGCCTGGG + Intergenic
936339334 2:111617486-111617508 GTGTGTATGTGCGTGTGTATGGG - Intergenic
936725909 2:115315246-115315268 GTGTGCATGTGTGTGTGTGCAGG - Intronic
936937397 2:117851531-117851553 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
937054478 2:118921627-118921649 TTGTGGATGTGCTTGTGTCAGGG - Intergenic
937108608 2:119343443-119343465 GTGTGCATATGCGTGTGTATGGG - Intronic
937121114 2:119440447-119440469 GATTGCAGGTGCATGTGCCCAGG - Intronic
937230455 2:120395476-120395498 ATGCGCATGTGCGTGTGTCAAGG - Intergenic
937324768 2:120983975-120983997 GTGTGCATGTTTATGAGTCCAGG + Intronic
937503777 2:122513366-122513388 GTGTGTATGTGGATGTGTGTAGG + Intergenic
937851026 2:126636473-126636495 TTGTGCATGTACATGTACCCTGG - Intergenic
937907945 2:127061474-127061496 GTGTGCATGTGTGTGTGTGAGGG - Intronic
937910262 2:127072216-127072238 GTGAGCCTGTGGATGTGGCCGGG - Intronic
939127522 2:138195077-138195099 GTGTGCATGTGTGTGTGTGTTGG - Intergenic
939414676 2:141879934-141879956 GTGTTCATATGTATATGTCCAGG - Intronic
940208165 2:151227389-151227411 GTGTGTGTGTGTGTGTGTCCAGG + Intergenic
940797853 2:158099496-158099518 GTGTGTGTGTGCATGTGTAAGGG + Intronic
941391049 2:164915066-164915088 GTGTTCATGTGCATTGGTACAGG - Intronic
942431995 2:175921554-175921576 ATGTACATGTGAGTGTGTCCAGG + Intergenic
942432274 2:175925144-175925166 GTGTGGATGTGCGTGTGTCAGGG - Exonic
942451184 2:176108681-176108703 GTGTGTGTGTGTGTGTGTCCGGG + Intronic
942561672 2:177226535-177226557 GTGTGTGTGTGCATGTGTGGAGG - Intergenic
942628580 2:177930774-177930796 ATGAGCATTTGCATTTGTCCAGG - Intronic
942803959 2:179908119-179908141 GTGTGTGTGTGCATGTGCGCGGG + Intergenic
943144548 2:184025461-184025483 AGGTGTATGTGCATGTGTACAGG + Intergenic
944992258 2:205251257-205251279 GTGTGCATGTGTACATGTACAGG + Intronic
945338401 2:208619833-208619855 GTGTGTGTGTGCATGTGTGCTGG + Intronic
945366107 2:208956407-208956429 GAATGCAGGTGCATGTATCCAGG - Intergenic
946477900 2:220026319-220026341 GTGTGTATGTGTGTGTATCCTGG + Intergenic
947025950 2:225738212-225738234 GTGTGTCTGTGTGTGTGTCCAGG + Intergenic
948161704 2:235830000-235830022 CTGTGTATGTCCAGGTGTCCTGG - Intronic
948231759 2:236354335-236354357 GTGTGCATGTGTGTGTGTGGGGG + Intronic
948327659 2:237139243-237139265 ATGTGCACGTGCATGTGTATTGG - Intergenic
948460040 2:238124639-238124661 GAGTGTACGTGCATGTGTGCAGG + Intronic
948460041 2:238124665-238124687 GTGTACATGTGTGTGTGTGCAGG + Intronic
948460047 2:238124807-238124829 GAGTGTACGTGCATGTGTGCAGG + Intronic
948585754 2:239018659-239018681 GTGTGTGTGTGCATATGTTCAGG - Intergenic
948680020 2:239627274-239627296 GTGTGTGTGTGCATGGGCCCTGG + Intergenic
948692187 2:239713137-239713159 GTGTGTGTGTGAATGTGTCTGGG + Intergenic
948788900 2:240366895-240366917 ATGTGCGTGTGCATGTATGCAGG - Intergenic
948941074 2:241196881-241196903 GTGTCCTTGTGCCTGTGTGCAGG + Intronic
949085836 2:242154510-242154532 GCATGCATGTGCATGTGTGTTGG - Intergenic
1168967587 20:1908222-1908244 GTGTCCGTGTGCCTGTGTTCGGG - Intronic
1169205625 20:3738848-3738870 GTGTGTGTGTGCATGTGTGCAGG + Intronic
1170356040 20:15492391-15492413 GTGTGCGTGTGTGTGTGTTCAGG + Intronic
1170568438 20:17619728-17619750 GCGTGTCTGTGCATCTGTCCAGG - Exonic
1170932840 20:20784309-20784331 GTGTGTATGTGCATGTGATGCGG + Intergenic
1171030391 20:21671243-21671265 GTGTGAATGTGCAAGTGTGGGGG - Intergenic
1171131200 20:22654264-22654286 GTGAGCATGTGCGTGTGTGTAGG - Intergenic
1171275924 20:23856359-23856381 GTGTGCATGTGGCTGTGTGGGGG - Intergenic
1171320870 20:24242969-24242991 CTGTGCATGTGCATGTATGCAGG - Intergenic
1171449508 20:25225850-25225872 GTGTGCCTGTGGTTCTGTCCTGG - Exonic
1171523176 20:25791176-25791198 GTGTGCATGTGTGTGTGTGTTGG - Intronic
1171553650 20:26064707-26064729 GTGTGCATGTGTGTGTGTGTTGG + Intergenic
1171813650 20:29764189-29764211 GTGTGCCTGTGTGTGTGTCGGGG - Intergenic
1171966816 20:31536705-31536727 GGGTGAATGTTCATGTGTGCAGG - Intronic
1171979359 20:31616675-31616697 GTGTGAATGTGTATTTGTCTTGG - Intergenic
1171993213 20:31712768-31712790 GTGTGTATGTGTGTGTGGCCAGG + Intronic
1172311865 20:33924672-33924694 GTGTGCGCGTGCATGTGTGATGG + Intergenic
1172713674 20:36947333-36947355 GTGTGTGTGTGTGTGTGTCCTGG + Intronic
1172713681 20:36947424-36947446 GTGTGTGTGTGTGTGTGTCCTGG + Intronic
1172713686 20:36947497-36947519 GTGTGTGTGTGTGTGTGTCCTGG + Intronic
1173181708 20:40811056-40811078 GTGTGCACATGCATGTGTGTAGG - Intergenic
1173349325 20:42230809-42230831 GTGTGCGTGTGCGTGTATACTGG + Intronic
1173418944 20:42883624-42883646 GTGTGCATATGCATGTGTATGGG - Intronic
1174146800 20:48458034-48458056 GTTTGCATGCACATGTGTCCAGG + Intergenic
1174151845 20:48491535-48491557 GTTTGCATGCACAGGTGTCCAGG + Intergenic
1174238560 20:49114574-49114596 GTGTGGATCTGCTGGTGTCCCGG + Exonic
1174957746 20:55118744-55118766 GTGTATATGTGCATGTGTGTGGG - Intergenic
1175139458 20:56849247-56849269 ATGTGTGTGTGCATGTGTGCAGG + Intergenic
1175226689 20:57448706-57448728 GTGTGCATGTGTGGGTGTGCTGG - Intergenic
1175430056 20:58895218-58895240 GTGTGAATGTTCATGTATCAGGG + Intronic
1175481205 20:59312481-59312503 GTGTGCAGGTGCCTGTGTTAGGG + Intronic
1175562744 20:59944968-59944990 ATGTGCATGTGCTTGTGTTTTGG - Exonic
1175741656 20:61423936-61423958 GTGGGCATGTGCCTGTGTACAGG - Intronic
1175932805 20:62500970-62500992 GTGTGGGTGTTCATGTGTGCGGG + Intergenic
1175932839 20:62501409-62501431 GTGTGGGTGTTCATGTGTGCGGG + Intergenic
1176176891 20:63732289-63732311 GTGTGTGTGTGCATGTGTGTGGG + Intronic
1176176900 20:63732346-63732368 GTGTGTGTGTGCATGTGTCAGGG + Intronic
1176987312 21:15452577-15452599 TTGTGAGGGTGCATGTGTCCAGG + Intergenic
1177306445 21:19323989-19324011 GTGTGAATGTGTATGTGTGTAGG - Intergenic
1179062469 21:37991707-37991729 GTGTGAATGTGCATGTGTAAGGG - Intronic
1179375851 21:40849163-40849185 GAGTGTATGGGCATGTGTGCAGG - Intergenic
1179532068 21:42026474-42026496 GTGTACATGTGTATGTGTGTGGG + Intergenic
1179728670 21:43354981-43355003 GTGTGCGTGTGCATCTGTGGTGG - Intergenic
1179728685 21:43355071-43355093 GTGTGCGTGTGCATCTGTGGTGG - Intergenic
1179903016 21:44403455-44403477 GTGTGCATGTGTGTGTGTGTTGG - Intronic
1180046643 21:45309322-45309344 GTGAGAGTCTGCATGTGTCCTGG - Intergenic
1180108456 21:45634974-45634996 GTGTGCATGTGTATGTGCTGTGG + Intergenic
1180572544 22:16741490-16741512 GTGTACATGTGCAGATGTGCAGG + Intergenic
1180761569 22:18213644-18213666 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1180774098 22:18410966-18410988 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181070207 22:20329979-20330001 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181107209 22:20582454-20582476 GTGTGCCTGTGTGTATGTCCAGG + Intronic
1181193201 22:21157916-21157938 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181216244 22:21334685-21334707 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1181461998 22:23091089-23091111 GTGTGCAGCTGCATGTGTACTGG - Intronic
1181557138 22:23677634-23677656 GTGTGCTTGGGCATGTCACCAGG - Intergenic
1181697235 22:24599911-24599933 GTGTGCTTGGGCATGTCACCAGG + Intronic
1182027647 22:27133043-27133065 TGGTGCACGTGCATGTGTGCTGG - Intergenic
1182279774 22:29211224-29211246 GTGTGTATGTGAATGTGTGAGGG + Intronic
1183474503 22:38028604-38028626 GTATGCACGTGCATGTCTCTGGG + Intronic
1183721325 22:39563306-39563328 GTGTGCATATCTATGTGTCTGGG + Intergenic
1184460418 22:44634669-44634691 ATGTGCATATGCACGTGTGCAGG - Intergenic
1184707696 22:46225680-46225702 GTGTCCATGTGCATGTATGGGGG - Intronic
1184739593 22:46419792-46419814 GAGTGCATGTGCATGGGTGAGGG - Intronic
1184833264 22:47004480-47004502 GTGTGTATAGGCATGTGTGCAGG - Intronic
1184868913 22:47220589-47220611 GTGTGCATGCCCATATGTACAGG - Intergenic
1184868919 22:47220650-47220672 GTGTGCATGCCCATATGTACAGG - Intergenic
1184868929 22:47220833-47220855 ATGTGCATGCACATGTGTACAGG - Intergenic
1184924626 22:47628315-47628337 GTGTGCATGTGTGTGTGTTGTGG + Intergenic
1184924637 22:47628460-47628482 GTGTGCATGTGAGTGTGTGTTGG + Intergenic
1184947573 22:47814879-47814901 GTGTGCATCTGCATGTGAACAGG + Intergenic
1185048740 22:48542349-48542371 GTGTGCATATGTGTGTGTGCGGG + Intronic
1185119322 22:48956333-48956355 GTGTGCATGTGTGTGTGGTCGGG - Intergenic
1185203785 22:49524897-49524919 GTGTGCATGTGGGTGTGTACGGG - Intronic
949112410 3:278013-278035 GTGAGCTTGTGCATGTGAGCTGG + Intronic
949309716 3:2683315-2683337 GTGTGTGTGTACATGTGTGCAGG - Intronic
949570258 3:5285573-5285595 GTGTGCATGTGCATGGCTCCAGG + Intergenic
949724540 3:7028206-7028228 GTGTGCATCTGCCTGACTCCTGG + Intronic
950539198 3:13599860-13599882 GTGGGCATGTGCATGTGACATGG + Intronic
950637895 3:14328737-14328759 TTGTGCTTGTGCATGTCTTCTGG + Intergenic
952089056 3:29862609-29862631 GTGTGTGTGTGCATGTGTGGTGG + Intronic
952803959 3:37328229-37328251 GTGTGTGTGTGTGTGTGTCCAGG - Intronic
953122815 3:40062163-40062185 GTTTGCCTGTTCCTGTGTCCAGG + Intronic
953246177 3:41195802-41195824 GTGTGCACGTGCGTGTGTTGCGG + Intronic
953563457 3:44012432-44012454 GTGTGCATTTGCACGTGTGTGGG - Intergenic
953743493 3:45556129-45556151 GTGTGTGTGTGCCTGTGCCCAGG + Intronic
953909411 3:46884105-46884127 GTGTGCATGTGTGTGTGTGAGGG - Intronic
953931520 3:47008187-47008209 GTGTGTGTATGCATGTGCCCTGG + Intronic
953969718 3:47337646-47337668 GTTTGCATGTGGATGTGAGCTGG + Intronic
954130013 3:48556091-48556113 GTGGGCCTGTGTCTGTGTCCCGG - Intronic
954616010 3:51968840-51968862 GTGTGCAAGTGCTTGTGTGGAGG + Exonic
955089420 3:55734574-55734596 GTGTTTATGTGCATGTGGCTGGG - Intronic
955111874 3:55958308-55958330 GTGTGAATCTGGATGAGTCCAGG + Intronic
955772885 3:62404282-62404304 GCGTGCATGTGCGTGTGTATTGG - Intronic
956851925 3:73236624-73236646 GTGTGTATGTGTATATATCCAGG - Intergenic
956884251 3:73543030-73543052 GTGTGTATTTGCATTTATCCAGG - Intronic
958130619 3:89416781-89416803 ATGTACATGTTTATGTGTCCAGG + Intronic
958849829 3:99311241-99311263 GTGTGCCTGTTCTTATGTCCAGG - Intergenic
958902913 3:99909032-99909054 GTGTGCATGTGTGTGTGCACAGG + Intronic
959422632 3:106147922-106147944 TTGTGCAGGTGTATTTGTCCAGG + Intergenic
960754931 3:121001149-121001171 CTGTGCATAGGCATGTGTACTGG + Intronic
960988137 3:123293522-123293544 GTGTGCATGTGCGTGTGTGTAGG - Intronic
961406554 3:126683791-126683813 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961406557 3:126683817-126683839 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961553280 3:127680917-127680939 GGGAGCATGAGCCTGTGTCCTGG + Exonic
961628973 3:128282536-128282558 GTGCACATGTGCACGTGTCCTGG - Intronic
961666237 3:128494642-128494664 GTGTGTATGTGCATGTATCTAGG + Intergenic
962344340 3:134608488-134608510 GTGTGCATGTGGATGAGTGGAGG - Intronic
962380271 3:134892977-134892999 GTGAGCATGTGCCTCTGTGCAGG - Intronic
962929003 3:140020360-140020382 GTGTGCATGTGTGTGTACCCAGG + Intronic
962975166 3:140439886-140439908 GTGTGCATGTTTATATGTCTGGG + Intronic
963005341 3:140721881-140721903 GTGTGTATGTGTATGTGTGTTGG - Intergenic
963332010 3:143925123-143925145 GTGTGTATGTGAATGTGGGCAGG - Intergenic
963431283 3:145207618-145207640 GTGTGTGTGTGCATGTGTGCGGG + Intergenic
964153624 3:153559138-153559160 TTGTGAAAGTGTATGTGTCCAGG - Intergenic
965009387 3:163066393-163066415 TTGGGAAGGTGCATGTGTCCAGG - Intergenic
965090781 3:164160179-164160201 TTGTGGAGGTGTATGTGTCCAGG + Intergenic
965775045 3:172220284-172220306 GTGTGCATGTGTTTGTGTGTTGG + Intronic
966608807 3:181848027-181848049 GTGTACATGTGCATTTTTCTGGG + Intergenic
967503023 3:190222305-190222327 GTGTGCATGTGCGTGTGTGTCGG + Intergenic
967858448 3:194134840-194134862 GTGTGTGTGTGTGTGTGTCCGGG - Intergenic
968215744 3:196888691-196888713 GTGTGCATATGCATTTGTATAGG + Intronic
968620005 4:1599785-1599807 GAGTGCCTGTGCAGGTGTCTGGG - Intergenic
968703654 4:2068335-2068357 GTGTACATGTGTTTGTGTCTTGG + Exonic
968933279 4:3595724-3595746 CTGTGCATGTTCATTTGTCATGG + Intergenic
968933808 4:3599055-3599077 GTGTGCATGTGAATGTGGGCAGG + Intergenic
968935746 4:3609382-3609404 GTGTGCATGTGTCTGTGTGTTGG - Intergenic
968955089 4:3714574-3714596 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
969259711 4:6025581-6025603 GGGAGAATGTGCAAGTGTCCAGG + Intergenic
969514632 4:7639561-7639583 GGGTGCATGTGAATGTGTGTGGG + Intronic
969532555 4:7737928-7737950 GAGACCATGTGCAGGTGTCCCGG - Intronic
969916599 4:10497815-10497837 GTGTGCCTTTGCATGTGCCAGGG - Intronic
971026854 4:22597708-22597730 GTGTGCATGTGTGTGTGTTATGG + Intergenic
971216124 4:24663726-24663748 GTGTGTGTGTGTGTGTGTCCAGG + Intergenic
971218048 4:24680328-24680350 ATGTGCATATGTAGGTGTCCTGG + Intergenic
971293126 4:25362928-25362950 GGGAGAATGTGCATGTGTCGGGG - Intronic
971779692 4:31016875-31016897 GTGTGCATATGTGTGTGTGCTGG + Intronic
972268596 4:37486774-37486796 GTGTGCATGTGTATGTTTTGGGG - Intronic
972406767 4:38753510-38753532 GTGTGCATGTGTATGTATATTGG - Intergenic
972905395 4:43740180-43740202 GTGTACATGTGTATGTGTACAGG - Intergenic
973166396 4:47083336-47083358 GTGTGCATGCACATGTGTAATGG - Intronic
974998883 4:69196174-69196196 GTGTGTGTGTGCATGTATCGGGG + Intronic
976337956 4:83912464-83912486 GTGTGTGTGTGCATGTGTATTGG - Intergenic
976689763 4:87856097-87856119 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
976829354 4:89296663-89296685 GTGTGCATATGTATGTGTGTGGG + Intronic
977564048 4:98563551-98563573 GTGTGCATGTGTATGTGTAGGGG - Intronic
978431633 4:108639402-108639424 GTGTGCACGTGCATTTTTCTAGG + Intergenic
978450395 4:108827105-108827127 GTGGGGAGGTGCATGTGACCAGG + Intronic
979237535 4:118419408-118419430 GCATGCATGTGCATGTGTGTTGG - Intergenic
979324039 4:119358168-119358190 GTGTGTATGTGCATGTATGAAGG + Intergenic
980208162 4:129748940-129748962 GTGTGTGTGTGCATGCGTGCAGG + Intergenic
980267306 4:130534158-130534180 GTGTGCATGTGCATATTTGTTGG - Intergenic
980944878 4:139309453-139309475 GTGTGTGTGTGTGTGTGTCCAGG + Intronic
981222092 4:142248664-142248686 GTGTGTATGTGTATGTGTTTAGG + Intronic
981582702 4:146266398-146266420 ATGTGCATGGGCATGTGTGGTGG - Intronic
981599982 4:146476499-146476521 GTGTGCATGTGCATGTGTCTTGG + Intronic
982418220 4:155162276-155162298 GTGTGCACGTGTGTGTGTCCTGG + Intergenic
982554986 4:156849757-156849779 CTGTGCATGGGTATGTATCCAGG + Intronic
982854229 4:160361575-160361597 GAGGGCATGTGCACATGTCCAGG + Intergenic
982925256 4:161329088-161329110 GTGTATATGTGCATGTGTTCTGG - Intergenic
983241877 4:165242854-165242876 GTGTGTATGTGCATGTATGAAGG + Intronic
983259120 4:165436181-165436203 GTGTGTGTGTGTATGTGTGCTGG - Intronic
983380551 4:166986820-166986842 GTGTGCATGTGTGTGTGTTGTGG - Intronic
983410873 4:167396278-167396300 GTGTGTATGTGTATGTGTAGTGG + Intergenic
983565564 4:169147459-169147481 GTGTGGATGTGCATGGGGGCAGG + Intronic
983884316 4:172963320-172963342 GTATGCATGTGGATGTGTGTGGG - Intronic
984587831 4:181583005-181583027 GTGTGCATGCACATGTGTGTGGG - Intergenic
984640203 4:182156842-182156864 GTGTCCAAGTGGCTGTGTCCTGG + Intronic
984699370 4:182808568-182808590 GTGTGCGTGTGCATATGTGTGGG + Intergenic
984699385 4:182808930-182808952 GTGTGCATGTGCGTGTGTGCAGG + Intergenic
984790621 4:183611565-183611587 GTGGGCATGTGCATGTGGTGTGG + Intergenic
985066675 4:186128884-186128906 GTGTGTATGTGTGTGTGTCTGGG + Intronic
985656890 5:1136924-1136946 GTGTGCACGTCTGTGTGTCCTGG - Intergenic
985656893 5:1136953-1136975 GAGTACATGTGTGTGTGTCCTGG - Intergenic
985791404 5:1930530-1930552 CTGTGCAGGTGCAGGTGTGCAGG + Intergenic
985833777 5:2255885-2255907 ATGTGTATGTGCATGTGTGTGGG + Intergenic
986042044 5:4003028-4003050 GTGTGCATGTGCATGTTCTGTGG - Intergenic
986042094 5:4003694-4003716 GTGTGCAGGTGCATGTGTGCAGG - Intergenic
986049974 5:4080929-4080951 GTGTGCATGTGCACCTGTGTGGG - Intergenic
986140872 5:5028460-5028482 TTGGGCAGGTGTATGTGTCCAGG - Intergenic
986803631 5:11286858-11286880 CTGTTCTTGTGCATGTGTCCTGG - Intronic
986925620 5:12745054-12745076 GTGTGTGTGTGCATGTGTATGGG + Intergenic
988223996 5:28388040-28388062 GTGTGCTTGTGCATGTATGACGG + Intergenic
988671045 5:33382140-33382162 GTGTGTGTGTGTGTGTGTCCAGG + Intergenic
988722235 5:33890683-33890705 GTGTGCGTGTGCATGCGTGTGGG + Intronic
988843255 5:35103965-35103987 CTGTGTAAGTGCATGTGCCCAGG + Intronic
988935769 5:36081586-36081608 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
988976751 5:36523719-36523741 GTGTGCATGTGTATGTGTGTTGG + Intergenic
989074863 5:37553578-37553600 GTGTGCTTGTGCATGTGCTGAGG + Intronic
989205447 5:38805006-38805028 GTGTGCACGTGCATATGTATGGG - Intergenic
990007924 5:50964490-50964512 GTGTGCGTGTGTGTGTGTACTGG - Intergenic
990037657 5:51341879-51341901 GGTTGCATGTGCATGAGTGCTGG + Intergenic
990073822 5:51817812-51817834 GTGAGCAACTTCATGTGTCCTGG + Intergenic
990365065 5:55062199-55062221 GTGTGCATATGCATGTGTGCAGG - Intergenic
990418462 5:55608765-55608787 GTGTGTGTGTGTATGTGTACAGG - Intergenic
990553529 5:56908573-56908595 GTGTGCGTGTGCATGCATCTGGG + Intergenic
990632488 5:57685509-57685531 GTGTGCATGTGCATGTGCATAGG + Intergenic
990970851 5:61504241-61504263 GAGTGCATGTGTGTGTGTCCAGG - Intronic
991513693 5:67410286-67410308 GTGTGCATGTGTATTGGTCAGGG + Intergenic
991957868 5:72013967-72013989 GTGTGCATGTGTATGTGCATGGG + Intergenic
992054930 5:72979342-72979364 GGGTGTATGTGTATGTGTCCAGG + Intronic
992357231 5:75998656-75998678 GTGTGAATGTGTATGTGTGTGGG + Intergenic
992536901 5:77715556-77715578 GTGTGCATGTGTGTGTGTCAGGG - Intronic
992723009 5:79578995-79579017 GTGTGTATTTGCATGTGTAGAGG + Intergenic
992751130 5:79863017-79863039 GTGTGCATGTGTGTGTTTTCTGG + Intergenic
993305605 5:86271687-86271709 GTGTGTCTGTGTGTGTGTCCAGG + Intergenic
993366803 5:87043533-87043555 GTGTGTGTGTGCACGTGTGCAGG + Intergenic
993547947 5:89236057-89236079 GTGTGTATGTGTATGTGTGTGGG + Intergenic
994039229 5:95238832-95238854 GTGTGCTTGTGTATGTATGCTGG - Intronic
994146696 5:96403034-96403056 ATGTGCAGGTGCATGTGTGGAGG + Intronic
994799057 5:104347186-104347208 GTGTGCATGTGTGTGTGCACAGG + Intergenic
994839907 5:104910239-104910261 GTGTGCATGTGCATGTGTTACGG - Intergenic
994939198 5:106299056-106299078 GTGTGCACGTGTATGTGACTGGG - Intergenic
995747016 5:115414856-115414878 GTGTGCATGTGTGTGTGTGTGGG + Intergenic
995810862 5:116105683-116105705 TTGGGCAGGTGTATGTGTCCAGG + Intronic
995914783 5:117231694-117231716 GTGTGTGTGTGCATGTGTTGGGG + Intergenic
996313675 5:122137141-122137163 ATGTGTATGTGCATGTGTATGGG + Intronic
996313676 5:122137147-122137169 ATGTGCATGTGTATGGGTGCAGG + Intronic
996384612 5:122898061-122898083 GTGTGCATGTATGTGTGTCGGGG + Intronic
996595508 5:125197712-125197734 GTGTGCATGTGTGTGTGTGAAGG + Intergenic
997085836 5:130797454-130797476 GTGTGTATGTGTATGTGTATTGG - Intergenic
997184211 5:131865702-131865724 GTGTGTATGTGCATATGTGTTGG + Intronic
997271495 5:132542614-132542636 GTATGCATTTGAATATGTCCTGG - Intronic
997646897 5:135487886-135487908 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
997707006 5:135965121-135965143 GTGTGTATGTGCATGTGTGAAGG - Intergenic
998144081 5:139716366-139716388 GTGTGTGTGTGTGTGTGTCCTGG + Intergenic
998388346 5:141771351-141771373 GTGTGCATGTGTGTGTCTCCTGG + Intergenic
998934065 5:147215851-147215873 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
999113814 5:149143806-149143828 GTTTGCATTTGCATGTTTTCAGG + Intronic
999126335 5:149248855-149248877 GTGTGTGTGTGTGTGTGTCCAGG - Intronic
999270940 5:150296064-150296086 GTGTGCATGTGTGTGTGTTGGGG - Intergenic
999668860 5:153940813-153940835 GTGTGCATGTGCATGTGGGTGGG - Intergenic
999719206 5:154386269-154386291 GTGTGAAGGTGCAGATGTCCTGG - Intronic
999734661 5:154503896-154503918 GTGTACGTGTGCATGTGTGTTGG + Intergenic
1000679886 5:164170440-164170462 GTGTGCATATGCATGTGTGTTGG + Intergenic
1001040619 5:168332523-168332545 GTGTGCACATGCATGTGTGCTGG + Intronic
1001158071 5:169290302-169290324 GTGTGCCTTAGCATGTGCCCTGG - Intronic
1001238122 5:170046753-170046775 GTGTGTATGTGTGTGTGTCTTGG - Intronic
1001533918 5:172485234-172485256 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1001813272 5:174646813-174646835 GTGTGGCTGTGCATGTTTGCAGG - Intergenic
1002095880 5:176830540-176830562 GTGTGCATGTGCATGTGTCCTGG + Intronic
1002564901 5:180105897-180105919 GTGTCACTGTGCTTGTGTCCAGG - Intronic
1002737973 5:181411376-181411398 GCATGCATGTGCATGTGTGTTGG - Intergenic
1002881527 6:1256783-1256805 GTATGCATGTGTGTGTGTCTTGG - Intergenic
1003036728 6:2646499-2646521 GAGTGGATGTGCATGTGTAGTGG + Intergenic
1003310398 6:4965208-4965230 GTGAGCACATGCATGTGTGCTGG + Intergenic
1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG + Intergenic
1003603309 6:7538647-7538669 GTGTGTATGTGCATGTGTGTGGG + Intergenic
1003790072 6:9536324-9536346 GTGTGCATGTGTATGTGTGTGGG + Intergenic
1003893902 6:10588851-10588873 GTGTGTATGTGTATGTGTGTGGG + Intronic
1004175171 6:13333556-13333578 GAGTTCCTGTGCATGTGTACAGG - Intergenic
1004351872 6:14897250-14897272 GTGTGTATGTGTGTGTGGCCAGG - Intergenic
1004584138 6:16983057-16983079 ATGTGTATGTGTGTGTGTCCTGG - Intergenic
1004867301 6:19866786-19866808 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1006095171 6:31651879-31651901 GTGTGAATGTGTGTGTGTGCAGG - Intronic
1006237018 6:32642550-32642572 GTGCTCATGTGCATGTGTGTGGG - Intronic
1006247003 6:32746180-32746202 GTGCTCATGTGCATGTGTGTGGG - Intronic
1006464641 6:34185340-34185362 TTGTGCATGTGTATGTGTGTGGG - Intergenic
1006497353 6:34433362-34433384 GTGTGTGTGTGTGTGTGTCCGGG - Intergenic
1006811998 6:36826152-36826174 GTGTGCATGCGCATGTGTTATGG + Intronic
1007696704 6:43738614-43738636 GTGTGCCTGTGCGTGTGTGTGGG + Intergenic
1007832435 6:44648746-44648768 GTGTGCATGTGCATGTGTAAAGG - Intergenic
1008248645 6:49209327-49209349 GTGTGTGTGTGCGTGTGTCTGGG - Intergenic
1008526902 6:52416761-52416783 GGCTGTGTGTGCATGTGTCCTGG - Intergenic
1009768230 6:68109812-68109834 GTGTGTGTGTGTGTGTGTCCAGG - Intergenic
1009878163 6:69532297-69532319 GTGTTCATGTGTATGTGTCTTGG + Intergenic
1010691219 6:78912981-78913003 GTGTGTATGTGTGTGTGTCATGG + Intronic
1011156780 6:84341834-84341856 GTGTGTGTGTGTATGTGTCCTGG + Intergenic
1011185150 6:84666510-84666532 GTATGAATGTACATGTGTACAGG - Intergenic
1011210541 6:84951427-84951449 GTGGCCATGTGAATGAGTCCTGG - Intergenic
1011595298 6:89010230-89010252 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1011999816 6:93639174-93639196 TTTTGTATGTGCATGTGTACAGG + Intergenic
1012328731 6:97957996-97958018 GTGTGTGTGTGTGTGTGTCCGGG + Intergenic
1012414103 6:98993953-98993975 GTGTGTATGTGCATATGTGCTGG - Intergenic
1012708199 6:102561754-102561776 GTGTGCATGTGCTTGTGTGTGGG + Intergenic
1012747636 6:103114682-103114704 GTGTGCATATGCAAGTGTGTGGG + Intergenic
1012804135 6:103873984-103874006 GTGTGTATGTGTGTGTGTTCTGG - Intergenic
1012950157 6:105509726-105509748 GTGTGCATGTGTGTGTGTGTGGG + Intergenic
1013233660 6:108177513-108177535 TTGTGCGTGTGCATGTGCCCAGG - Intronic
1013535671 6:111061053-111061075 GCGTGCATGTGCATGTGGGGAGG - Intergenic
1013935748 6:115590890-115590912 TTGTGTATGTGCATGTGTGAAGG - Intergenic
1014519260 6:122420041-122420063 GTGTGCATGTGTGTGTGTTTGGG + Intronic
1015044606 6:128762373-128762395 GTGAGCATGTGCATGGATGCTGG + Intergenic
1015577958 6:134692754-134692776 GTGTGTTTGTGTATGTGTCAGGG - Intergenic
1015609164 6:134996802-134996824 GTTTGCATATGCATGGGTCTTGG - Exonic
1016319831 6:142830844-142830866 GTGTGGATGTGCATGCATTCTGG - Intronic
1016553623 6:145310596-145310618 GTGTGTATGTGTGTGTGTACGGG - Intergenic
1016557351 6:145353506-145353528 TTGTGCATGTGAATGTGTGTGGG - Intergenic
1016962980 6:149691246-149691268 CTCTGCATGTGCATGTGTCTGGG - Intronic
1017798501 6:157869775-157869797 GTGTGCCTGTGCACGTGCACAGG - Intronic
1017951153 6:159136458-159136480 GTGTGCACATGCATGTATGCAGG + Intergenic
1018165346 6:161088991-161089013 GTGTGCATGTGTGTGTGTATTGG - Intronic
1018243621 6:161801779-161801801 CTGTGCAACTGCGTGTGTCCAGG + Intronic
1018300433 6:162396737-162396759 GTGTGCATGTGCATATGGGAGGG - Intronic
1018691117 6:166344901-166344923 TTGTGCATGTCCTTGTGTTCAGG - Intergenic
1018732265 6:166660322-166660344 GTGTGCATGTGTGTGTGTGCGGG + Intronic
1019018154 6:168895648-168895670 GTGTGTGTGTGTGTGTGTCCCGG + Intergenic
1019127869 6:169852879-169852901 ATGTGCATGTGCACGTGTGTGGG + Intergenic
1019134579 6:169900001-169900023 CTGTGCATCTGCCTCTGTCCCGG + Intergenic
1019135845 6:169907206-169907228 GTGTGCAGGTGTGTGTGTGCAGG - Intergenic
1019137380 6:169919048-169919070 GTGTGTGTGTGCGTGTGTGCAGG + Intergenic
1019243074 6:170686935-170686957 GCATGCATGTGCATGTGTGTTGG - Intergenic
1019888295 7:3924491-3924513 CAGTGAATGTGCATGTGACCAGG - Intronic
1019922871 7:4173995-4174017 GTTTTCATGTGCATGTGTGTGGG - Intronic
1020033018 7:4946164-4946186 GCGTGTGTGTGCATGTGTGCAGG - Intronic
1020077813 7:5270080-5270102 GTGTGGATGTACCTGTTTCCAGG - Intergenic
1020860497 7:13486854-13486876 TTGGGAAGGTGCATGTGTCCAGG - Intergenic
1021027066 7:15683047-15683069 GTGTCCATGTGCATTTGTGGAGG + Intronic
1021239244 7:18180216-18180238 GTGTGTGTGTGTATGTGTCTTGG - Intronic
1021280320 7:18708919-18708941 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1022006854 7:26273672-26273694 GAGTGCAGGTGCATTTCTCCTGG + Intergenic
1022492224 7:30829916-30829938 GTGTGTGTGTGCATGTTTTCTGG + Intronic
1022846175 7:34212282-34212304 GTGTGCATGTGGAAGTGTGGAGG - Intergenic
1023096316 7:36663231-36663253 GGGAGCCTGTGCATGTGTCGGGG - Intronic
1023162587 7:37311673-37311695 CTGTGGGTGTGCATGTGTCACGG - Intronic
1023454968 7:40328765-40328787 GTGTGTATGTGTATGTGTTTTGG + Intronic
1023542085 7:41276332-41276354 GTGTGCATGTGCGTGCATGCAGG + Intergenic
1023981608 7:45073804-45073826 GTGGGCCTGTGCTTGGGTCCTGG + Intronic
1024550940 7:50561843-50561865 GTGTGCATGTGTGTGTGGTCGGG - Intronic
1024668324 7:51567079-51567101 GTGTGTGTGTGTGTGTGTCCTGG + Intergenic
1024748527 7:52434777-52434799 TTTTGAATGTGTATGTGTCCTGG + Intergenic
1024854036 7:53755874-53755896 GTGTGTGTGTGCATGTGTCTGGG - Intergenic
1024866698 7:53911542-53911564 GTGTGCATGTGGATGGGGGCGGG - Intergenic
1024883767 7:54118105-54118127 GTGTGTGCGTGCATGTGTGCAGG - Intergenic
1024970781 7:55068112-55068134 GTGTGTGTGTGCATGTGTGGTGG + Intronic
1025201073 7:56962091-56962113 GTGTGGATGTACCTGTTTCCAGG + Intergenic
1025670871 7:63614841-63614863 GTGTGGATGTACCTGTTTCCAGG - Intergenic
1026014550 7:66662723-66662745 GTGTGCAGGTGTAAGTGTGCAGG + Intronic
1026014554 7:66662791-66662813 GTGTGCAGGTGTATGTGTGTAGG + Intronic
1026331030 7:69352756-69352778 GTGTGCATGTGTGTATGTCTAGG - Intergenic
1026527222 7:71164699-71164721 GTGTGTGTGTGCATGTGACAAGG + Intronic
1026795758 7:73364924-73364946 GTGTGTGTGTGTGTGTGTCCAGG + Intergenic
1026890333 7:73977933-73977955 GTGTGCAGGTGTGTGTGTTCAGG + Intergenic
1026975683 7:74496568-74496590 GTGTGGGTGTGCATGTGTGTGGG + Intronic
1027749190 7:82120199-82120221 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1028127533 7:87130944-87130966 GTGTGCCTGTGTGTGTGTGCAGG - Intergenic
1028704283 7:93820005-93820027 GTGTGCATGTGTGTGTGTGTTGG + Intronic
1029156666 7:98522090-98522112 GTGTGCATGTGCCTGTGTGAGGG + Intergenic
1029789896 7:102831390-102831412 GTGTGTGTGTGTGTGTGTCCCGG - Intronic
1029878171 7:103776028-103776050 GTGTGCATGTGCATGCATCCCGG + Intronic
1029893546 7:103957561-103957583 ATGAGCATGTGCGTGTGACCAGG - Intronic
1030202772 7:106922214-106922236 TTGGGCAGGTGTATGTGTCCAGG - Intergenic
1031775227 7:125900647-125900669 GTGTGTATGTGTGTGTGTCAAGG - Intergenic
1031957083 7:127953509-127953531 ATTTGCATGTGCATGTGGACTGG + Intronic
1032248315 7:130231738-130231760 GTGTGCAGGTGAATGGGTGCAGG + Intergenic
1032525479 7:132576295-132576317 GTGTGCGTGTGCGTGTGCCGCGG + Intronic
1032854913 7:135825959-135825981 GTGTGCATGTGTGTGTGTTGGGG + Intergenic
1033190729 7:139276498-139276520 GTGTGCATATGGATCTGTCCTGG - Intronic
1033601277 7:142890144-142890166 GTGTGCATGTGTGTGTCTGCAGG - Intergenic
1033601287 7:142890341-142890363 GTGTGCATGTGTGTGTCTGCAGG - Intergenic
1033601299 7:142890565-142890587 GTGTGCATGTGTGTGTCTGCAGG - Intergenic
1033638053 7:143230915-143230937 GTGTGTATGTGAATGTGTGTTGG - Intergenic
1033765611 7:144486949-144486971 GTGCGCATGTGTATGTGTCTTGG - Intronic
1034307065 7:150052354-150052376 GTGTGTATGTGTGTGTGTGCTGG - Intergenic
1034411155 7:150942843-150942865 GTGTGCATGTGTCTGTGCTCAGG - Intergenic
1034577842 7:152016608-152016630 GTTTTCTTGTTCATGTGTCCTGG - Intronic
1034799783 7:154048328-154048350 GTGTGTATGTGTGTGTGTCCTGG + Intronic
1035048704 7:155985761-155985783 GTGTGCATGTGCATGCATGCAGG + Intergenic
1035494646 7:159313345-159313367 GTGTTCAAGAGCATGTGTCAGGG - Intergenic
1035505048 8:121228-121250 GCATGCATGTGCATGTGTGTTGG + Intergenic
1035526825 8:320072-320094 GTGTCCAGGTGTGTGTGTCCAGG + Intergenic
1035526827 8:320086-320108 GTGTCCAGGTGTGTGTGTCCAGG + Intergenic
1035526831 8:320128-320150 GTGTCCAGGTGTGTGTGTCCAGG + Intergenic
1035644730 8:1210313-1210335 GTCTGGAAGGGCATGTGTCCAGG + Intergenic
1035664055 8:1367094-1367116 GTGGTCATGTGCATGTGTGTTGG - Intergenic
1036034780 8:5007233-5007255 ATGTGCATTTGCATGGGTGCAGG + Intergenic
1036127580 8:6077257-6077279 GTGTGCACGTGTGTGTGTCTGGG + Intergenic
1036212149 8:6851127-6851149 GTGTGCATGTAGGTGTGTGCAGG - Intergenic
1036212189 8:6851513-6851535 GTGTGCATGTAGGTGTGTGCAGG - Intergenic
1036590816 8:10166533-10166555 GTGTGCATGTGCATTTGTATGGG + Intronic
1037405168 8:18534780-18534802 GTGGGCATGGGGTTGTGTCCTGG - Exonic
1037716669 8:21406853-21406875 GTGTGTATATGCATGTGTGTGGG + Intergenic
1037721155 8:21445147-21445169 GTGTGCACACACATGTGTCCAGG - Intergenic
1037731830 8:21532514-21532536 GTGTGCATGTGCATGCATGTAGG - Intergenic
1037806481 8:22060434-22060456 GTGTGCGTGCGCATGTGTGAGGG - Intronic
1037807583 8:22067037-22067059 GTGGGCACGTGCGTGTGTGCGGG - Intronic
1038199299 8:25396782-25396804 GTGTGTGTGTGTGTGTGTCCCGG + Intronic
1039129287 8:34243462-34243484 GTGTGCATGTGTATGTATTTTGG + Intergenic
1039377185 8:37046354-37046376 GAATGTATGTGCATGTGTACTGG - Intergenic
1039442396 8:37604278-37604300 ATGTGCGTGTGCATGTGTGTGGG - Intergenic
1039902219 8:41761334-41761356 ATGTGCATGTGTATGTGTGCAGG - Intronic
1041326289 8:56669483-56669505 GTGTACATATGTGTGTGTCCAGG - Intergenic
1041430839 8:57778874-57778896 TTGTGCATGTGCATGTGTTTTGG - Intergenic
1043010408 8:74874730-74874752 GTGTGTGTGTGTATGTGTGCAGG - Intergenic
1043920393 8:85976192-85976214 GAGTGCATGTGCATGTATTCTGG - Intergenic
1043935336 8:86136250-86136272 GTGTGCATGTGTGTGTATTCAGG - Intronic
1043961194 8:86420510-86420532 GTGTAGATGTGTATGTGTGCAGG + Intronic
1044069068 8:87733541-87733563 GTGTGTGTGTGCATGTGTGCAGG - Intergenic
1044626368 8:94237883-94237905 GTGTGTATGTGTATGTGTTGAGG - Intergenic
1044881702 8:96729863-96729885 GTGTGTATGGGCATGTGACATGG + Intronic
1044884891 8:96766541-96766563 GTGGCCCTGTGCATGTGTCAGGG + Intronic
1045402838 8:101835728-101835750 GTGTGAGTGTGCATGTGGCCAGG + Intronic
1045839651 8:106564400-106564422 GTGTGTGTGTGTATGTGTCCAGG - Intronic
1046087485 8:109456262-109456284 GTGTGCCTGTTCCTGTGACCTGG + Exonic
1046283087 8:112059245-112059267 GTGTACATGTGCATGTGCCATGG + Intergenic
1046547949 8:115675188-115675210 GTATACATGGGCATGTGTCTGGG + Intronic
1046624897 8:116566039-116566061 CTGTGCACGTGCAGGTGTGCTGG + Intergenic
1046739020 8:117809171-117809193 GTATGTATGTGCATGTGTGTAGG + Intronic
1047122155 8:121916824-121916846 GTGTGCATGTGTATTTGTGTTGG + Intergenic
1047159642 8:122363362-122363384 GTGTGCATGTTTGTGTGTGCTGG - Intergenic
1047248218 8:123162316-123162338 GTGTGTATGTGTGTGTGTTCTGG + Intergenic
1047463738 8:125092539-125092561 GTGTACATGTGCATGTGATAGGG + Intronic
1047694603 8:127391086-127391108 GTGTGCATGGGAGTGTGTCAGGG + Intergenic
1047735300 8:127759844-127759866 GTGTGCATGGGCATGCATTCTGG + Intergenic
1048162971 8:132037935-132037957 GTGTGCATGGGCATGTGTGGGGG - Intronic
1048266007 8:132987367-132987389 ATGTGTATGTGTATGTGTACAGG + Intronic
1048305597 8:133281855-133281877 ATGTGCATGTGAGTGTGTACTGG + Intronic
1048379179 8:133849220-133849242 GTGTGCATGCGCATGTGTGGTGG + Intergenic
1048379749 8:133854972-133854994 GTGCACATGTGCATGTGTGGTGG + Intergenic
1048552245 8:135444401-135444423 GCATGCATGTGCATGTGTGATGG + Intergenic
1048856585 8:138691291-138691313 GTGTGCACGTGCGTGTGTGCAGG + Intronic
1048856600 8:138691573-138691595 GTGTGCGTGTGCATTTGTGAAGG + Intronic
1048880763 8:138870875-138870897 GTGTGCATGTGCTTCTATCTAGG + Intronic
1049076926 8:140404838-140404860 GTGTGTACGTGCCTGTGTGCGGG + Intronic
1049115488 8:140683268-140683290 TTGGGAATGTGTATGTGTCCAGG - Intronic
1049159497 8:141088253-141088275 GTGTGTGTGTGCATGTGTATGGG - Intergenic
1049251903 8:141593724-141593746 GGGTGTGTGTGCATGTGTGCAGG + Intergenic
1049407060 8:142456336-142456358 GTGTGCACATGCGTGTGTGCAGG - Intronic
1049420998 8:142516614-142516636 GTGTGTGTGTGCATGTGTGCGGG + Intronic
1049520762 8:143088983-143089005 GTGTCCATTTGCATGTGTCCTGG - Intergenic
1049525486 8:143124117-143124139 GTGTGCATGTACATGTGTGAGGG - Intergenic
1049525558 8:143124831-143124853 GTGTGCATGTACATATGTGAGGG - Intergenic
1049525572 8:143124998-143125020 GTGTGCATGTACATTTGTGAGGG - Intergenic
1049535995 8:143182588-143182610 GTGTGCATGTGAGTGTGTCTGGG + Intergenic
1049950389 9:638038-638060 GTGTGCATCTGTATGTAACCTGG - Intronic
1050275846 9:3998968-3998990 GTATGCATGTGCTTATGTCTTGG - Intronic
1050445789 9:5721435-5721457 GTGTGCACGCGCGTGTGTGCTGG - Intronic
1052400114 9:27989467-27989489 GTGTGTGTGTGTATGTGTGCAGG + Intronic
1053094360 9:35311510-35311532 GTGTGCATGTACTTATGTACAGG + Intronic
1053172967 9:35904205-35904227 GTGTGTATGTGTATGTGTGAGGG + Intergenic
1053397754 9:37789778-37789800 GTGTGTGTGTGCCTGTGTCATGG + Intronic
1054454437 9:65422496-65422518 GTGTGCATGTGTCTGTGTGTTGG + Intergenic
1054456856 9:65436085-65436107 CTGTGCATGTTCATTTGTCATGG - Intergenic
1054726024 9:68651020-68651042 ATGTGCATGTGAATCTGTCGGGG + Intergenic
1055056710 9:72030632-72030654 GTGCACATGTGGGTGTGTCCTGG + Intergenic
1055118264 9:72628489-72628511 GTGTGCACTTGCATGTGTGTGGG + Intronic
1055185977 9:73454672-73454694 GTGTGTATGTGTATGTTTCAGGG + Intergenic
1055381998 9:75717522-75717544 GTGTGCATGTGTATGTGTCGAGG - Intergenic
1056460343 9:86803749-86803771 GTGTGCATATGCATGTGTGTTGG + Intergenic
1056687324 9:88777392-88777414 GTGTGTGTGTGCATGTGTACGGG + Intergenic
1056705404 9:88948349-88948371 ATGTGCATGGGTATGTGTGCAGG + Intergenic
1056705409 9:88948417-88948439 GTGTGCCTGGGTATGTGTGCAGG + Intergenic
1056926830 9:90842485-90842507 GTGTGTATGTGTATGTGTGTGGG + Intronic
1056961476 9:91128204-91128226 GTGTGCATGTACATGTTTGTGGG + Intergenic
1057381614 9:94572318-94572340 GTGTGCGTGTGTGTGTGTCGTGG - Intronic
1058480906 9:105394445-105394467 GTGTGTGTGTGTGTGTGTCCTGG + Exonic
1058744931 9:107981273-107981295 GTGTGCATTTGCACGTGTGTGGG + Intergenic
1059168445 9:112100853-112100875 GTGTGTGTGTGTGTGTGTCCAGG - Intronic
1059784241 9:117563361-117563383 GGGTGCATGTGTTTGTGTACAGG + Intergenic
1060116587 9:120946190-120946212 GTGTGTATGTGCATGTTTCTGGG + Intergenic
1060442157 9:123651375-123651397 GTGTGTACGTGCATGTGCTCAGG - Intronic
1060759762 9:126237305-126237327 GTGTGCATGTGCATGCATTTGGG + Intergenic
1061140802 9:128765194-128765216 GTGTACATGTGCATGGATGCAGG - Intronic
1061209963 9:129185667-129185689 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1061245516 9:129399505-129399527 GTGTGCATGTGCATGTCTGTGGG - Intergenic
1061650673 9:132046774-132046796 GTGTGTATGTGCGTATGTGCGGG - Intronic
1061935286 9:133854066-133854088 GGGTGTATGTGCAGGTGTGCAGG - Intronic
1062104274 9:134744608-134744630 GTGTGCATGAGTGTGTGTGCAGG - Intronic
1062104519 9:134746234-134746256 GTGTGCATGTGGTTCTGTCCAGG - Intronic
1062316151 9:135967948-135967970 GTGTGCATGTTCATGTGTGCGGG + Intergenic
1062562401 9:137147389-137147411 GTGTGCATGTGTGTCTGTGCTGG - Intronic
1203769505 EBV:41674-41696 GTGTGCAGATGCAGGTCTCCGGG + Intergenic
1203376561 Un_KI270442v1:382215-382237 GTGTCCATGTGTGTGTGCCCGGG + Intergenic
1203603263 Un_KI270748v1:36159-36181 GCATGCATGTGCATGTGTGTTGG - Intergenic
1185615129 X:1417112-1417134 GTGTCTGTGTGCATGTGTCTGGG - Intronic
1185845147 X:3430863-3430885 GTGTGTGTGTGTGTGTGTCCAGG - Intergenic
1185881851 X:3748349-3748371 GTGTGTGTGTGTATGTGTGCAGG + Intergenic
1187244923 X:17545503-17545525 GTGCCCATGTGAATGAGTCCTGG - Intronic
1187694805 X:21908643-21908665 GTGTGCATGTGTATGGGACGAGG - Intergenic
1187832993 X:23401584-23401606 GTAAGCATGTGCATATGTACAGG - Exonic
1188550181 X:31355648-31355670 GTGTGCATGTGTCTGTGTTGGGG + Intronic
1188668045 X:32848995-32849017 GTGTGTATGTGCATGTGCTGGGG + Intronic
1189211369 X:39286813-39286835 GTGTGCATGTGCCTATGTAGAGG - Intergenic
1189363853 X:40373235-40373257 GTGTGTATGTGCATGTGTATAGG + Intergenic
1191957949 X:66666791-66666813 GTGTGTGTGTGCATGTGTAGGGG + Intergenic
1192148314 X:68696346-68696368 GTGTGCATGGGCATGCATTCGGG + Intronic
1192185502 X:68944253-68944275 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1193188989 X:78547020-78547042 GTGTGTGTGTGTGTGTGTCCTGG - Intergenic
1193497611 X:82233609-82233631 GTGTGTGTGTGCATGTCTGCTGG + Intergenic
1194861675 X:99006247-99006269 GTTTGCATGTGCATGTGGAGAGG + Intergenic
1195029599 X:100913367-100913389 GTGTGTATGTGTATGTGTGTAGG - Intergenic
1195712362 X:107783874-107783896 GTGTGTGTGTGTGTGTGTCCAGG + Intronic
1196193740 X:112819189-112819211 GTGTGCATGTGTGTGTGGCTGGG - Intronic
1196348557 X:114698423-114698445 GTGTGTTTGTGCCTGTGTTCTGG - Intronic
1197123984 X:122923113-122923135 TTGTGAGGGTGCATGTGTCCAGG + Intergenic
1198301970 X:135342494-135342516 GTGTGTATGTGCTTGTGTGGAGG + Exonic
1198778943 X:140213903-140213925 GTGTGTGTGTGTATGTATCCAGG - Intergenic
1198978591 X:142366839-142366861 GTATGCATGTGCATGTGAGCAGG + Intergenic
1199085373 X:143622639-143622661 GTATGCATGTGTATGTGTGTAGG + Intergenic
1199744906 X:150766389-150766411 CTGTTCACGTGCTTGTGTCCAGG - Exonic
1199868276 X:151873896-151873918 GTGTGCGTGTGCATGCATCTGGG + Intergenic
1199881594 X:151977714-151977736 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1199943246 X:152644922-152644944 GTGAGCATGTGAATGTGTGTAGG - Intronic
1200913791 Y:8553799-8553821 ATGTGCATGTGCTAGTCTCCTGG + Intergenic
1201153902 Y:11112430-11112452 GGGTGCATGTGCATTTGTTTTGG + Intergenic
1201293450 Y:12444070-12444092 GTGTACACATGCATGTGTACAGG - Intergenic
1201340243 Y:12925618-12925640 GTGTGCGTCTGCACGTGTCAGGG + Intergenic
1201450700 Y:14110417-14110439 GGGTGACTGTGCATGTGTCAGGG - Intergenic
1201671904 Y:16531508-16531530 GTGTGTGTGTGTGTGTGTCCAGG - Intergenic
1201751966 Y:17442409-17442431 TTGTGAGGGTGCATGTGTCCAGG + Intergenic
1202111896 Y:21429374-21429396 GTGTACCTCTGCATGTGCCCCGG - Intergenic