ID: 1002098774

View in Genome Browser
Species Human (GRCh38)
Location 5:176847131-176847153
Sequence GGCGCCCGACTTCAACGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 9}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002098774_1002098781 11 Left 1002098774 5:176847131-176847153 CCCGTTCGTTGAAGTCGGGCGCC 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1002098781 5:176847165-176847187 CATGCCCGACGGCTGGAGCCAGG No data
1002098774_1002098784 17 Left 1002098774 5:176847131-176847153 CCCGTTCGTTGAAGTCGGGCGCC 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1002098784 5:176847171-176847193 CGACGGCTGGAGCCAGGCCCTGG 0: 1
1: 0
2: 3
3: 13
4: 247
1002098774_1002098778 0 Left 1002098774 5:176847131-176847153 CCCGTTCGTTGAAGTCGGGCGCC 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1002098778 5:176847154-176847176 GGCTGATTCTCCATGCCCGACGG 0: 1
1: 0
2: 0
3: 3
4: 67
1002098774_1002098779 4 Left 1002098774 5:176847131-176847153 CCCGTTCGTTGAAGTCGGGCGCC 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1002098779 5:176847158-176847180 GATTCTCCATGCCCGACGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 41
1002098774_1002098785 20 Left 1002098774 5:176847131-176847153 CCCGTTCGTTGAAGTCGGGCGCC 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1002098785 5:176847174-176847196 CGGCTGGAGCCAGGCCCTGGTGG 0: 1
1: 0
2: 5
3: 62
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002098774 Original CRISPR GGCGCCCGACTTCAACGAAC GGG (reversed) Intronic
906214270 1:44030196-44030218 CGCGCCCCACTTCGAGGAACCGG - Intronic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1135047685 16:19168401-19168423 GGCGCCCGATATCTCCGAACCGG + Exonic
1152606810 17:81295476-81295498 GGGGCCCCAGTTCAACGAGCTGG + Intronic
1160710534 19:549152-549174 GGCGGCCGACTCCAAGGACCAGG + Exonic
1166387458 19:42390195-42390217 GGCGCCCAACCTCAAAGAAGAGG + Intronic
929900729 2:46000981-46001003 GGTGCCAGACTTCAATGAGCAGG + Intronic
951865674 3:27304693-27304715 GTCCCCAGACTTCAACAAACAGG + Intronic
954926875 3:54243721-54243743 GGCTCCAGACTTCAAACAACTGG + Intronic
1002098774 5:176847131-176847153 GGCGCCCGACTTCAACGAACGGG - Intronic